Core Reproductive Screen Duo with FMR1 repeat expansion
Is a 126-gene panel for couples who want information about their chance to have a child with an autosomal recessive or X-linked genetic condition. This type of test is sometimes called carrier screening.
This test includes the analysis of the CGG repeat region in the 5’-UTR of the FMR1 gene using PCR amplification and fragment size analysis to determine CGG repeat length.
Please note that, to ensure proper result of the repeat expansion analysis we require sample type to be blood, buccal, or DNA extracted from either of those two sample types.
Duo report will combine results of the two tested individuals, to provide reproductive risk assessment for a couple in one test. FMR1 repeat expansion analysis will be performed only for the female individual.
Please note that for DUO testing we must receive the samples from both individuals in order to start the analysis.
The number of CGG repeats are reported when an intermediate (45-54 repeats) or premutation (55-200 repeats) allele is detected. CGG repeat number is not reported for normal size alleles (5-44 repeats). Full mutation alleles are reported as >200 repeats.
- PLUS
Summary
The Blueprint Genetics Core Reproductive Screen Duo with FMR1 repeat expansion (test code CS0104):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
The strengths of this test include:
-CAP-accredited laboratory
-CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
-Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
-Careful construction of clinically effective and scientifically justified gene panels
-Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
-Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
-~2,000 noncoding disease-causing variants in our clinical grade NGS assay for panels (please see ‘Noncoding disease-causing variants covered by this panel’ in the Panel Content section)
-Our rigorous variant classification scheme
-Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
-Our comprehensive clinical statements
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
The Core Reproductive Screen Duo with FMR1 repeat expansion is intended for healthy couples interested in carrier screening. Carrier screening gives individuals and/or couples an estimate of their chances of having a child affected with an autosomal recessive or X-linked condition. With this information, individuals or couples can discuss with their healthcare provider to make informed decisions about their reproductive options with medical advice. This might include choosing prenatal diagnosis, preimplantation genetic testing, use of a donor gamete/embryo, adoption, no testing, etc.
In a Duo report, results of the 2 tested individuals are combined to provide reproductive risk assessment for a couple in 1 test.
The Core Reproductive Screen Duo with FMR1 repeat expansion test includes screening for:
- 101 of 113 disorders recommended by the American College of Obstetricians and Gynecologists (ACOG) and the American College of Medical Genetics (ACMG) (PMID: 34285390)
- Fragile XE syndrome (AFF2), hemophilia A (F8), Friedreich ataxia (FXN), and classic-like Ehlers-Danlos syndrome (TNXB) are not included due to limitations in variant detection by short-read NGS methods (eg. repeat expansions, structural rearrangements, high degree of homology etc)
- Alpha-methylacetoacetic aciduria (ACAT1), congenital adrenal insufficiency (CYP11A1), Fraser syndrome 3 (GRIP1), megalencephalic leukoencephalopathy with subcortical cysts 1 (MLC1), methylmalonic aciduria (MMUT), Schindler disease (NAGA) pontocerebellar hypoplasia type 6 (RARS2), and atransferrinemia (TF) are currently not included, as they are rare or have significant variability in clinical presentation
- A number of genes associated with serious childhood-onset conditions
Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.
Genes in the Core Reproductive Screen Duo with FMR1 repeat expansion
More information about this test content: Residual risk table.
The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
Some, or all, of the gene is duplicated in the genome. Read more.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Core Reproductive Screen Duo with FMR1 repeat expansion
To view complete table content, scroll horizontally.
| Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
|---|---|---|---|---|
| ABCA3 | Chr16:2333457 | c.3863-98C>T | NM_001089.2 | rs189077405 |
| ABCA3 | Chr16:2358644 | c.1112-20G>A | NM_001089.2 | rs746701685 |
| ABCA3 | Chr16:2376495 | c.-26-2A>G | NM_001089.2 | |
| ABCC6 | Chr16:16244424 | c.4403+11C>G | NM_001171.5 | rs72664215 |
| ABCC6 | Chr16:16256835 | c.3506+15G>A | NM_001171.5 | rs72664302 |
| ABCC6 | Chr16:16281097 | c.1780-29T>A | NM_001171.5 | rs72664206 |
| ABCC6 | Chr16:16284246 | c.1432-22C>A | NM_001171.5 | rs72664297 |
| ABCC8 | Chr11:17415959 | c.4412-13G>A | NM_000352.3 | rs1008906426 |
| ABCC8 | Chr11:17427028 | c.3399+13G>A | NM_000352.3 | rs182340196 |
| ABCC8 | Chr11:17449501 | c.2041-12C>A | NM_000352.3 | |
| ABCC8 | Chr11:17449510 | c.2041-21G>A | NM_000352.3 | rs746714109 |
| ABCC8 | Chr11:17449514 | c.2041-25G>A | NM_000352.3 | |
| ABCC8 | Chr11:17452526 | c.1672-20A>G | NM_000352.3 | |
| ABCC8 | Chr11:17465872 | c.1333-1013A>G | NM_000352.3 | |
| ABCC8 | Chr11:17470268 | c.1177-53_1177-51delGTG | NM_000352.3 | rs1271038564 |
| ACADM | Chr1:76200457 | c.388-19T>A | NM_000016.4 | |
| ACADM | Chr1:76211473 | c.600-18G>A | NM_000016.4 | rs370523609 |
| ACADVL | Chr17:7123160 | c.-144_-132delCCCAGCATGCCCCinsT | NM_000018.3 | |
| ACADVL | Chr17:7125469 | c.822-27C>T | NM_001270447.1 | rs374911841 |
| ACADVL | Chr17:7125485 | c.822-11T>G | NM_001270447.1 | |
| ACADVL | Chr17:7126199 | c.1146+15C>T | NM_001270447.1 | rs202237278 |
| ACADVL | Chr17:7126948 | c.1252-15A>G | NM_001270447.1 | rs765390290 |
| ACADVL | Chr17:7127894 | c.1747+23C>T | NM_001270447.1 | rs147546456 |
| ALDOB | Chr9:104183575 | c.*516T>A | NM_000035.3 | |
| ALDOB | Chr9:104197990 | c.-11+1G>C | NM_000035.3 | rs181639417 |
| ALDOB | Chr9:104198194 | NM_000035.3 | rs185972191 | |
| ALPL | Chr1:21835920 | c.-195C>T | NM_000478.4 | |
| ALPL | Chr1:21896764 | c.793-30_793-11delGGCATGTGCTGACACAGCCC | NM_000478.4 | |
| ARSA | Chr22:51064121 | c.1108-12C>G | NM_000487.5 | rs757806374 |
| ARSA | Chr22:51064129 | c.1108-20A>G | NM_000487.5 | |
| ASS1 | Chr9:133327601 | c.-5-10C>G | NM_000050.4 | rs375136377 |
| ASS1 | Chr9:133355236 | c.773+49C>T | NM_000050.4 | rs763389916 |
| ATP7B | Chr13:52518439 | c.3061-12T>A | NM_000053.3 | |
| ATP7B | Chr13:52585551 | c.-78A>C | NM_000053.3 | |
| ATP7B | Chr13:52585596 | c.-123C>A | NM_000053.3 | |
| ATP7B | Chr13:52585596 | c.-128_-124delAGCCG | NM_000053.3 | |
| ATP7B | Chr13:52585606 | c.-133A>C | NM_000053.3 | |
| ATP7B | Chr13:52585683 | c.-210A>T | NM_000053.3 | |
| ATP7B | Chr13:52585894 | NM_000053.3 | rs1484840087 | |
| ATP7B | Chr13:52585897 | NM_000053.3 | ||
| ATP7B | Chr13:52585915 | c.-442G>A | NM_000053.3 | |
| BBS1 | Chr11:66291105 | c.951+58C>T | NM_024649.4 | |
| BTD | Chr3:15683399 | c.310-15delT | NM_000060.2 | rs587783008 |
| CBS | Chr21:44496326 | c.-86_-85+8delAGGTAGAAGA | NM_001178008.1 | |
| CEP290 | Chr12:88462434 | c.6012-12T>A | NM_025114.3 | rs752197734 |
| CEP290 | Chr12:88494960 | c.2991+1655A>G | NM_025114.3 | rs281865192 |
| CEP290 | Chr12:88508350 | c.1910-11T>G | NM_025114.3 | |
| CEP290 | Chr12:88534822 | c.103-18_103-13delGCTTTT | NM_025114.3 | |
| CFTR | Chr7:117119654 | c.-495C>T | NM_000492.3 | rs397507565 |
| CFTR | Chr7:117119797 | NM_000492.3 | ||
| CFTR | Chr7:117119900 | c.-249G>C | NM_000492.3 | |
| CFTR | Chr7:117119984 | c.-165G>A | NM_000492.3 | rs145483167 |
| CFTR | Chr7:117120064 | c.-85C>G | NM_000492.3 | |
| CFTR | Chr7:117120115 | c.-34C>T | NM_000492.3 | rs756314710 |
| CFTR | Chr7:117120325 | c.53+124T>C | NM_000492.3 | |
| CFTR | Chr7:117179040 | c.870-1113_870-1110delGAAT | NM_000492.3 | rs397508809 |
| CFTR | Chr7:117182041 | c.1117-26_1117-25delAT | NM_000492.3 | rs397508159 |
| CFTR | Chr7:117199500 | c.1393-18G>A | NM_000492.3 | rs397508199 |
| CFTR | Chr7:117227774 | c.1585-19T>C | NM_000492.3 | rs778457306 |
| CFTR | Chr7:117227921 | c.1679+34G>T | NM_000492.3 | rs767901668 |
| CFTR | Chr7:117229521 | c.1680-886A>G | NM_000492.3 | rs397508266 |
| CFTR | Chr7:117229524 | c.1680-883A>G | NM_000492.3 | |
| CFTR | Chr7:117229530 | c.1680-877G>T | NM_000492.3 | rs397508261 |
| CFTR | Chr7:117243855 | c.2908+19G>C | NM_000492.3 | rs370683572 |
| CFTR | Chr7:117246713 | c.2909-15T>G | NM_000492.3 | rs397508455 |
| CFTR | Chr7:117246840 | c.2988+33G>T | NM_000492.3 | |
| CFTR | Chr7:117251609 | c.3140-26A>G | NM_000492.3 | rs76151804 |
| CFTR | Chr7:117251619 | c.3140-16T>A | NM_000492.3 | rs767232138 |
| CFTR | Chr7:117251624 | c.3140-11A>G | NM_000492.3 | |
| CFTR | Chr7:117266272 | c.3469-1304C>G | NM_000492.3 | |
| CFTR | Chr7:117267864 | c.3717+40A>G | NM_000492.3 | rs397508595 |
| CFTR | Chr7:117280015 | c.3718-2477C>T | NM_000492.3 | rs75039782 |
| CFTR | Chr7:117282680 | c.3873+33A>G | NM_000492.3 | rs397508622 |
| CFTR | Chr7:117288374 | c.3874-4522A>G | NM_000492.3 | |
| CHRNE | Chr17:4804936 | c.501-16G>A | NM_000080.3 | |
| CHRNE | Chr17:4806452 | c.-94G>A | NM_000080.3 | |
| CHRNE | Chr17:4806453 | c.-95G>A | NM_000080.3 | |
| CHRNE | Chr17:4806454 | c.-96C>T | NM_000080.3 | rs748144899 |
| CLCN1 | Chr7:143013247 | c.-59C>A | NM_000083.2 | |
| CLCN1 | Chr7:143029494 | c.1167-15_1167-14delCT | NM_000083.2 | rs1214185689 |
| CLN3 | Chr16:28493392 | c.1056+34C>A | NM_000086.2 | |
| CLN3 | Chr16:28497984 | c.461-13G>C | NM_000086.2 | rs386833721 |
| CLRN1 | Chr3:150660197 | c.254-649T>G | NM_001195794.1 | rs976853535 |
| COL7A1 | Chr3:48602516 | c.8620+26G>A | NM_000094.3 | |
| COL7A1 | Chr3:48604008 | c.8305-12T>A | NM_000094.3 | |
| COL7A1 | Chr3:48605244 | c.7929+11_7929+26delGATGGGGGCTGGGGGG | NM_000094.3 | rs773394779 |
| COL7A1 | Chr3:48605981 | c.7759-18_7759-14delCATCTinsTTCA | NM_000094.3 | |
| COL7A1 | Chr3:48613354 | c.5821-19A>G | NM_000094.3 | |
| COL7A1 | Chr3:48616971 | c.5236-23A>G | NM_000094.3 | |
| COL7A1 | Chr3:48626035 | c.2587+40G>A | NM_000094.3 | |
| COL7A1 | Chr3:48629915 | c.977-15G>A | NM_000094.3 | |
| COL7A1 | Chr3:48632779 | c.-187C>T | NM_000094.3 | |
| COL7A1 | Chr3:48632780 | c.-188C>T | NM_000094.3 | |
| CYP21A2 | Chr6:32006858 | c.293-13C>G | NM_000500.7 | rs6467 |
| DHDDS | Chr1:26774026 | c.441-24A>G | NM_024887.3 | rs764831063 |
| DMD | ChrX:31165653 | c.10554-18C>G | NM_004006.2 | |
| DMD | ChrX:31200680 | c.9974+175T>A | NM_004006.2 | |
| DMD | ChrX:31224814 | c.9564-30A>T | NM_004006.2 | |
| DMD | ChrX:31225211 | c.9564-427T>G | NM_004006.2 | |
| DMD | ChrX:31226400 | c.9563+1215A>G | NM_004006.2 | |
| DMD | ChrX:31229031 | c.9362-1215A>G | NM_004006.2 | |
| DMD | ChrX:31241047 | c.9361+117A>G | NM_004006.2 | |
| DMD | ChrX:31279293 | c.9225-160A>G | NM_004006.2 | |
| DMD | ChrX:31279418 | c.9225-285A>G | NM_004006.2 | |
| DMD | ChrX:31279420 | c.9225-287C>A | NM_004006.2 | |
| DMD | ChrX:31279780 | c.9225-647A>G | NM_004006.2 | rs398124091 |
| DMD | ChrX:31279781 | c.9225-648A>G | NM_004006.2 | rs398124084 |
| DMD | ChrX:31332523 | c.9224+9192C>A | NM_004006.2 | |
| DMD | ChrX:31382270 | c.9085-15519G>T | NM_004006.2 | |
| DMD | ChrX:31613687 | c.8217+32103G>T | NM_004006.2 | |
| DMD | ChrX:31627738 | c.8217+18052A>G | NM_004006.2 | |
| DMD | ChrX:31697714 | c.7661-11T>C | NM_004006.2 | |
| DMD | ChrX:31983146 | c.6614+3310G>T | NM_004006.2 | rs797045526 |
| DMD | ChrX:32305833 | c.6118-15A>G | NM_004006.2 | |
| DMD | ChrX:32360414 | c.5740-15G>T | NM_004006.2 | |
| DMD | ChrX:32366860 | c.5326-215T>G | NM_004006.2 | |
| DMD | ChrX:32379144 | c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA | NM_004006.2 | |
| DMD | ChrX:32398808 | c.4675-11A>G | NM_004006.2 | |
| DMD | ChrX:32460274 | c.3787-843C>A | NM_004006.2 | |
| DMD | ChrX:32470726 | c.3603+2053G>C | NM_004006.2 | |
| DMD | ChrX:32479316 | c.3432+2240A>G | NM_004006.2 | |
| DMD | ChrX:32479520 | c.3432+2036A>G | NM_004006.2 | |
| DMD | ChrX:32669100 | c.961-5831C>T | NM_004006.2 | rs398124099 |
| DMD | ChrX:32669194 | c.961-5925A>C | NM_004006.2 | |
| DMD | ChrX:32716130 | c.832-15A>G | NM_004006.2 | rs72470513 |
| DMD | ChrX:32827744 | c.531-16T>A/G | NM_004006.2 | |
| DMD | ChrX:32827744 | c.531-16T>A | NM_004006.2 | |
| DMD | ChrX:32827744 | c.531-16T>G | NM_004006.2 | |
| DMD | ChrX:32841967 | c.265-463A>G | NM_004006.2 | |
| DMD | ChrX:33032666 | c.93+5590T>A | NM_004006.2 | |
| DMD | ChrX:33192452 | c.31+36947G>A | NM_004006.2 | |
| DMD | ChrX:33229483 | c.-54T>A | NM_004006.2 | |
| DYNC2H1 | Chr11:103019205 | c.2819-14A>G | NM_001080463.1 | rs781091611 |
| DYNC2H1 | Chr11:103055609 | c.6478-16G>A | NM_001080463.1 | rs376892534 |
| F9 | ChrX:138612869 | c.-55G>A/C/T | NM_000133.3 | |
| F9 | ChrX:138612869 | NM_000133.3 | ||
| F9 | ChrX:138612869 | NM_000133.3 | ||
| F9 | ChrX:138612869 | NM_000133.3 | ||
| F9 | ChrX:138612871 | c.-53A>G | NM_000133.3 | |
| F9 | ChrX:138612871 | NM_000133.3 | ||
| F9 | ChrX:138612872 | c.-52C>G/T | NM_000133.3 | |
| F9 | ChrX:138612872 | NM_000133.3 | ||
| F9 | ChrX:138612872 | NM_000133.3 | ||
| F9 | ChrX:138612874 | c.-50T>C/G | NM_000133.3 | |
| F9 | ChrX:138612874 | NM_000133.3 | ||
| F9 | ChrX:138612874 | NM_000133.3 | ||
| F9 | ChrX:138612875 | c.-49T>A/C | NM_000133.3 | |
| F9 | ChrX:138612875 | NM_000133.3 | ||
| F9 | ChrX:138612875 | NM_000133.3 | rs1178811105 | |
| F9 | ChrX:138612876 | c.-48G>C | NM_000133.3 | |
| F9 | ChrX:138612886 | c.-38A>G | NM_000133.3 | |
| F9 | ChrX:138612889 | c.-35G>A/C | NM_000133.3 | |
| F9 | ChrX:138612889 | NM_000133.3 | rs1166164399 | |
| F9 | ChrX:138612889 | NM_000133.3 | ||
| F9 | ChrX:138612890 | c.-34A>G/T | NM_000133.3 | |
| F9 | ChrX:138612890 | NM_000133.3 | ||
| F9 | ChrX:138612890 | NM_000133.3 | ||
| F9 | ChrX:138612899 | c.-22delT | NM_000133.3 | |
| F9 | ChrX:138612900 | c.-24T>A | NM_000133.3 | |
| F9 | ChrX:138612901 | c.-23T>C | NM_000133.3 | |
| F9 | ChrX:138612902 | c.-22T>C | NM_000133.3 | |
| F9 | ChrX:138612903 | c.-21C>G | NM_000133.3 | |
| F9 | ChrX:138612905 | c.-19C>G | NM_000133.3 | |
| F9 | ChrX:138612905 | c.-17delA | NM_000133.3 | |
| F9 | ChrX:138612906 | c.-18A>G/T | NM_000133.3 | |
| F9 | ChrX:138612906 | c.-18A>T | NM_000133.3 | |
| F9 | ChrX:138612906 | c.-18A>G | NM_000133.3 | |
| F9 | ChrX:138612907 | c.-17A>C/G | NM_000133.3 | |
| F9 | ChrX:138612907 | c.-17A>C | NM_000133.3 | |
| F9 | ChrX:138612907 | c.-17A>G | NM_000133.3 | |
| F9 | ChrX:138619496 | c.253-25A>G/T | NM_000133.3 | |
| F9 | ChrX:138619496 | c.253-25A>T | NM_000133.3 | |
| F9 | ChrX:138619496 | c.253-25A>G | NM_000133.3 | rs1201753038 |
| F9 | ChrX:138619501 | c.253-19_253-16delCTTC | NM_000133.3 | |
| F9 | ChrX:138619502 | c.253-16_253-12delCTTTT | NM_000133.3 | |
| F9 | ChrX:138623222 | c.278-13A>G | NM_000133.3 | |
| F9 | ChrX:138623223 | c.278-12C>G/T | NM_000133.3 | |
| F9 | ChrX:138623223 | c.278-12C>G | NM_000133.3 | |
| F9 | ChrX:138623223 | c.278-12C>T | NM_000133.3 | rs1475223858 |
| F9 | ChrX:138630499 | c.392-22_392-21delCT | NM_000133.3 | |
| F9 | ChrX:138630663 | c.520+13A>G | NM_000133.3 | |
| F9 | ChrX:138633441 | c.723+18T>A | NM_000133.3 | |
| F9 | ChrX:138645387 | c.*1157A>G | NM_000133.3 | |
| F9 | ChrX:138645598 | c.*1368A>G | NM_000133.3 | |
| FANCA | Chr16:89805127 | c.4261-19_4261-12delACCTGCTC | NM_000135.3 | |
| FANCA | Chr16:89816056 | c.3239+82T>G | NM_000135.2 | |
| FANCA | Chr16:89818822 | c.2982-192A>G | NM_000135.2 | |
| FANCA | Chr16:89831215 | c.2778+83C>G | NM_000135.2 | rs750997715 |
| FANCA | Chr16:89836111 | c.2504+134A>G | NM_000135.2 | |
| FANCA | Chr16:89836805 | c.2223-138A>G | NM_000135.2 | |
| FANCA | Chr16:89849346 | c.1567-20A>G | NM_000135.2 | rs775154397 |
| FANCC | Chr9:98011653 | c.-78-2A>G | NM_000136.2 | rs587779898 |
| FANCC | Chr9:98079807 | c.-79+1G>A | NM_000136.2 | |
| FKRP | Chr19:47249328 | c.-272G>A | NM_024301.4 | |
| FKTN | Chr9:108368857 | c.648-1243G>T | NM_006731.2 | |
| FMR1 | ChrX:147031110 | c.*746T>C | NM_002024.5 | rs183130936 |
| G6PC | Chr17:41059684 | c.446+39G>A | NM_000151.3 | |
| G6PC | Chr17:41059687 | c.446+42G>A | NM_000151.3 | |
| GAA | Chr17:78078341 | c.-32-13T>G | NM_000152.3 | rs386834236 |
| GAA | Chr17:78078341 | c.-32-13T>A | NM_000152.3 | |
| GAA | Chr17:78078351 | c.-32-3C>A/G | NM_000152.3 | |
| GAA | Chr17:78078352 | c.-32-2A>G | NM_000152.3 | |
| GAA | Chr17:78078353 | c.-32-1G>C | NM_000152.3 | |
| GAA | Chr17:78078369 | c.-17C>T | NM_000152.3 | |
| GAA | Chr17:78082266 | c.1076-22T>G | NM_000152.3 | rs762260678 |
| GAA | Chr17:78090422 | c.2190-345A>G | NM_000152.3 | |
| GAA | Chr17:78092432 | c.2647-20T>G | NM_000152.3 | |
| GALT | Chr9:34646572-34646576 | c.-119_-116delGTCA | ||
| GALT | Chr9:34646606 | c.-96T>G | NM_000155.3 | |
| GALT | Chr9:34647075 | c.83-11T>G | NM_000155.3 | |
| GALT | Chr9:34648082 | c.508-29delT | NM_000155.3 | rs111033711 |
| GALT | Chr9:34648519 | c.687+66T>A | NM_000155.3 | |
| GALT | Chr9:34648904 | c.820+13A>G | NM_000155.3 | rs111033768 |
| GALT | Chr9:34649617 | c.1059+56C>T | NM_000155.3 | rs111033821 |
| GBA | Chr1:155205646 | c.1225-14_1225-11delTGTCinsAGT | NM_000157.3 | |
| GBA | Chr1:155208109 | c.589-12C>G | NM_000157.3 | |
| GBA | Chr1:155211053 | c.-150A>G | NM_000157.3 | rs1232943445 |
| GJB2 | Chr13:20763744 | c.-22-2A>C | NM_004004.5 | rs201895089 |
| GJB2 | Chr13:20766920 | c.-23+2T>A | NM_004004.5 | |
| GJB2 | Chr13:20766921 | c.-23+1G>A | NM_004004.5 | rs80338940 |
| GJB2 | Chr13:20766922 | c.-23G>T | NM_004004.5 | rs786204734 |
| GJB2 | Chr13:20767158 | c.-259C>T | NM_004004.5 | |
| GJB2 | Chr13:20767159 | c.-260C>T | NM_004004.5 | |
| GLA | ChrX:100653945 | c.640-11T>A | NM_000169.2 | |
| GLA | ChrX:100654735 | c.640-801G>A | NM_000169.2 | rs199473684 |
| GLA | ChrX:100654793 | c.640-859C>T | NM_000169.2 | rs869312374 |
| GLA | ChrX:100656225 | c.547+395G>C | NM_000169.2 | |
| GNPTAB | Chr12:102159106 | c.1613-25delA | NM_024312.4 | rs777271928 |
| HBA1 | Chr16:227471 | c.*63_*65delCCT | NM_000558.3 | |
| HBA2 | Chr16:223646 | c.*47G>C | NM_000517.4 | rs4021971 |
| HBA2 | Chr16:223672 | c.*74_*89delCCTTCCTGGTCTTTGA | NM_000517.4 | rs63750919 |
| HBA2 | Chr16:223690 | c.*93_*94delAA | NM_000517.4 | rs63751268 |
| HBA2 | Chr16:223691 | c.*92A>G | NM_000517.4 | rs63750067 |
| HBA2 | Chr16:223693 | c.*94A>G | NM_000517.4 | |
| HBA2 | Chr16:223693 | c.*94A>C | NM_000517.4 | |
| HBA2 | Chr16:223703 | c.*104G>T | NM_000517.4 | |
| HBB | Chr11:5246696 | c.*132C>A/T | NM_000518.4 | |
| HBB | Chr11:5246696 | c.*132C>A | NM_000518.4 | rs1420779550 |
| HBB | Chr11:5246696 | c.*132C>T | NM_000518.4 | |
| HBB | Chr11:5246699 | c.*129T>C | NM_000518.4 | |
| HBB | Chr11:5246711 | c.*115_*116delAA | NM_000518.4 | rs281864532 |
| HBB | Chr11:5246713 | c.*110_*114delTAAAA | NM_000518.4 | rs606231219,rs35949130 |
| HBB | Chr11:5246715 | c.*113A>G | NM_000518.4 | rs33985472 |
| HBB | Chr11:5246716 | c.*112A>G/T | NM_000518.4 | rs63750954 |
| HBB | Chr11:5246716 | c.*112A>T | NM_000518.4 | |
| HBB | Chr11:5246716 | c.*112A>G | NM_000518.4 | |
| HBB | Chr11:5246716 | c.*110_*111delTA | NM_000518.4 | rs63750205,rs281864905 |
| HBB | Chr11:5246717 | c.*111A>G | NM_000518.4 | rs63751128 |
| HBB | Chr11:5246718 | c.*110T>A/C | NM_000518.4 | rs33978907 |
| HBB | Chr11:5246718 | c.*110T>G | NM_000518.4 | |
| HBB | Chr11:5246720 | c.*108A>C/G | NM_000518.4 | |
| HBB | Chr11:5246720 | c.*108A>C | NM_000518.4 | |
| HBB | Chr11:5246720 | c.*108A>G | NM_000518.4 | |
| HBB | Chr11:5246722 | c.*93_*105delATCTGGATTCTGC | NM_000518.4 | rs34171453 |
| HBB | Chr11:5246732 | c.*96T>C | NM_000518.4 | rs34029390 |
| HBB | Chr11:5246754 | c.*74A>G | NM_000518.4 | rs369101035 |
| HBB | Chr11:5246781 | c.*47C>G | NM_000518.4 | |
| HBB | Chr11:5246796 | c.*32A>C | NM_000518.4 | |
| HBB | Chr11:5246970 | c.316-14T>G | NM_000518.4 | rs35703285 |
| HBB | Chr11:5247046 | c.316-90A>G | NM_000518.4 | rs63750433 |
| HBB | Chr11:5247062 | c.316-106C>G | NM_000518.4 | rs34690599 |
| HBB | Chr11:5247102 | c.316-146T>G | NM_000518.4 | rs35328027 |
| HBB | Chr11:5247153 | c.316-197C>T | NM_000518.4 | rs34451549 |
| HBB | Chr11:5247216 | c.316-260T>C | NM_000518.4 | |
| HBB | Chr11:5247602 | c.315+203_315+205delTCTinsCC | NM_000518.4 | |
| HBB | Chr11:5248044 | c.93-15T>G | NM_000518.4 | rs35456885 |
| HBB | Chr11:5248050 | c.93-21G>A | NM_000518.4 | rs35004220 |
| HBB | Chr11:5248050 | c.93-22delT | NM_000518.4 | |
| HBB | Chr11:5248263 | c.-12C>T | NM_000518.4 | rs113115948 |
| HBB | Chr11:5248269 | c.-18C>G | NM_000518.4 | rs34135787 |
| HBB | Chr11:5248272 | c.-21T>A | NM_000518.4 | |
| HBB | Chr11:5248280 | c.-29G>A/T | NM_000518.4 | rs34704828 |
| HBB | Chr11:5248281 | c.-31delC | NM_000518.4 | |
| HBB | Chr11:5248282 | c.-31C>T | NM_000518.4 | rs63750628 |
| HBB | Chr11:5248291 | c.-41delT | NM_000518.4 | rs35352549 |
| HBB | Chr11:5248294 | c.-43C>T | NM_000518.4 | |
| HBB | Chr11:5248301 | c.-50A>C | NM_000518.4 | rs34305195 |
| HBB | Chr11:5248301 | c.-50A>G/T | NM_000518.4 | |
| HBB | Chr11:5248326 | c.-75G>T | NM_000518.4 | |
| HBB | Chr11:5248326 | c.-75G>C | NM_000518.4 | rs63750400 |
| HBB | Chr11:5248326 | NM_000518.4 | rs63750953 | |
| HBB | Chr11:5248327 | c.-76A>C | NM_000518.4 | rs281864525 |
| HBB | Chr11:5248328 | c.-77A>G/T | NM_000518.4 | |
| HBB | Chr11:5248328 | NM_000518.4 | ||
| HBB | Chr11:5248328 | NM_000518.4 | ||
| HBB | Chr11:5248329 | c.-78A>C/G | NM_000518.4 | rs33931746 |
| HBB | Chr11:5248329 | NM_000518.4 | ||
| HBB | Chr11:5248329 | NM_000518.4 | ||
| HBB | Chr11:5248330 | c.-79A>G | NM_000518.4 | rs34598529 |
| HBB | Chr11:5248330 | NM_000518.4 | rs397509430 | |
| HBB | Chr11:5248331 | c.-80T>A/C | NM_000518.4 | rs33980857 |
| HBB | Chr11:5248331 | NM_000518.4 | ||
| HBB | Chr11:5248331 | NM_000518.4 | ||
| HBB | Chr11:5248332 | c.-81A>C/G | NM_000518.4 | rs33981098 |
| HBB | Chr11:5248332 | NM_000518.4 | ||
| HBB | Chr11:5248332 | NM_000518.4 | ||
| HBB | Chr11:5248333 | c.-82C>A/T | NM_000518.4 | rs34500389 |
| HBB | Chr11:5248333 | NM_000518.4 | ||
| HBB | Chr11:5248333 | NM_000518.4 | ||
| HBB | Chr11:5248342 | c.-91A>C | NM_000518.4 | |
| HBB | Chr11:5248343 | c.-92C>G | NM_000518.4 | rs397515291 |
| HBB | Chr11:5248351 | c.-100G>A | NM_000518.4 | rs281864524 |
| HBB | Chr11:5248372 | c.-121C>T | NM_000518.4 | rs281864518 |
| HBB | Chr11:5248373 | NM_000518.4 | rs1272414751 | |
| HBB | Chr11:5248374 | c.-123A>T | NM_000518.4 | |
| HBB | Chr11:5248377 | c.-126C>A | NM_000518.4 | |
| HBB | Chr11:5248378 | c.-127G>C | NM_000518.4 | |
| HBB | Chr11:5248384 | NM_000518.4 | rs72561473 | |
| HBB | Chr11:5248387 | c.-136C>A/G/T | NM_000518.4 | rs33994806 |
| HBB | Chr11:5248387 | NM_000518.4 | ||
| HBB | Chr11:5248387 | NM_000518.4 | ||
| HBB | Chr11:5248387 | NM_000518.4 | ||
| HBB | Chr11:5248388 | c.-137C>A/G/T | NM_000518.4 | rs33941377 |
| HBB | Chr11:5248388 | NM_000518.4 | ||
| HBB | Chr11:5248388 | NM_000518.4 | ||
| HBB | Chr11:5248388 | NM_000518.4 | ||
| HBB | Chr11:5248389 | c.-138C>A/T | NM_000518.4 | rs33944208 |
| HBB | Chr11:5248389 | NM_000518.4 | ||
| HBB | Chr11:5248389 | NM_000518.4 | ||
| HBB | Chr11:5248391 | NM_000518.4 | rs34999973 | |
| HBB | Chr11:5248393 | c.-142C>T | NM_000518.4 | rs34883338 |
| HBB | Chr11:5248394 | c.-143C>G | NM_000518.4 | rs63751043 |
| HBB | Chr11:5248402 | c.-151C>T | NM_000518.4 | rs63751208 |
| HBB | Chr11:5248402 | NM_000518.4 | ||
| HBB | Chr11:5248403 | c.-152C>A | NM_000518.4 | |
| HBB | Chr11:5248491 | c.-240G>A | NM_000518.4 | rs753344875 |
| HBB | Chr11:5248524 | c.-273T>C | NM_000518.4 | rs139703273 |
| HEXA | Chr15:72640009 | c.1146+18A>G | NM_000520.4 | |
| HPS3 | Chr3:148888270 | c.2888-1612G>A | NM_032383.3 | rs281865096 |
| L1CAM | ChrX:153128846 | c.3531-12G>A | NM_000425.4 | |
| L1CAM | ChrX:153131293 | c.2432-19A>C | NM_000425.4 | |
| L1CAM | ChrX:153133652 | c.1704-75G>T | NM_000425.4 | |
| L1CAM | ChrX:153133926 | c.1547-14delC | NM_000425.4 | |
| L1CAM | ChrX:153136500 | c.523+12C>T | NM_000425.4 | |
| MCCC2 | Chr5:70898313 | c.384-20A>G | NM_022132.4 | rs770917710 |
| MCCC2 | Chr5:70939634 | c.1073-12C>G | NM_022132.4 | rs1280511914 |
| MVK | Chr12:110029032 | c.769-7dupT | NM_000431.2 | rs104895348 |
| NEB | Chr2:152355017 | c.24220-151C>A | NM_001271208.1 | |
| NPHS1 | Chr19:36335378 | c.1931-17C>A | NM_004646.3 | |
| NPHS1 | Chr19:36336259 | c.1930+11C>A | NM_004646.3 | |
| NPHS1 | Chr19:36343206 | c.-475_-468delGAGAGAGA | NM_004646.3 | rs386833860 |
| OCA2 | Chr15:28234823 | c.1117-11T>A | NM_000275.2 | |
| OCA2 | Chr15:28234829 | c.1117-17T>C | NM_000275.2 | rs200081580 |
| OCA2 | Chr15:28235808 | c.1045-15T>G | NM_000275.2 | rs779461179 |
| OCA2 | Chr15:28267738 | c.574-19A>G | NM_000275.2 | rs145242923 |
| OTC | ChrX:38202566 | c.-9384G>T | NM_000531.5 | |
| OTC | ChrX:38211584 | NM_000531.5 | rs191615506 | |
| OTC | ChrX:38211793 | c.-157T>G | NM_000531.5 | |
| OTC | ChrX:38211808 | c.-142G>A | NM_000531.5 | |
| OTC | ChrX:38211811 | c.-139A>G | NM_000531.5 | |
| OTC | ChrX:38211834 | c.-116C>T | NM_000531.5 | |
| OTC | ChrX:38211835 | c.-115C>T | NM_000531.5 | |
| OTC | ChrX:38211844 | c.-106C>A | NM_000531.5 | rs749748052 |
| OTC | ChrX:38260946 | c.540+265G>A | NM_000531.5 | |
| OTC | ChrX:38272343 | c.1005+1091C>G | NM_000531.5 | |
| PAH | Chr12:103232809 | c.*144A>G | NM_000277.1 | rs375319584 |
| PAH | Chr12:103237404 | c.1199+20G>C | NM_000277.1 | rs62509018 |
| PAH | Chr12:103237407 | c.1199+17G>A | NM_000277.1 | rs62508613 |
| PAH | Chr12:103237568 | c.1066-11G>A | NM_000277.1 | rs5030855 |
| PAH | Chr12:103237568 | c.1066-12delT | NM_000277.1 | |
| PAH | Chr12:103237570 | c.1066-13T>G | NM_000277.1 | |
| PAH | Chr12:103237571 | c.1066-14C>G | NM_000277.1 | rs62507334 |
| PAH | Chr12:103238075 | c.1065+39G>T | NM_000277.1 | rs62510582 |
| PAH | Chr12:103260355 | c.509+15_509+18delCTTG | NM_000277.1 | rs1335303703 |
| PAH | Chr12:103288709 | c.169-13T>G | NM_000277.1 | rs62507341 |
| PCCA | Chr13:100958030 | c.1285-1416A>G | NM_000282.3 | |
| PCCB | Chr3:136003251 | c.714+462A>G | NM_001178014.1 | |
| PCDH15 | Chr10:56560684 | c.-29+1G>C | NM_001142763.1 | |
| PEX6 | Chr6:42933858 | c.2301-15C>G | NM_000287.3 | rs267608236 |
| PEX6 | Chr6:42933952 | c.2300+28G>A | NM_000287.3 | rs267608237 |
| PEX7 | Chr6:137143759 | c.-45C>T | NM_000288.3 | rs267608252 |
| PKHD1 | Chr6:51618610 | c.8798-459C>A | NM_138694.3 | |
| PKHD1 | Chr6:51747238 | c.7350+653A>G | NM_138694.3 | |
| PLP1 | ChrX:103031997 | c.4+78_4+85delGGGGGTTC | NM_000533.3 | |
| PLP1 | ChrX:103041680 | c.453+28_453+46delTAACAAGGGGTGGGGGAAA | NM_000533.3 | |
| PLP1 | ChrX:103042405 | c.454-322G>A | NM_000533.3 | |
| PLP1 | ChrX:103042413 | c.454-314T>A/G | NM_000533.3 | |
| PLP1 | ChrX:103042413 | c.454-314T>A | NM_000533.3 | |
| PLP1 | ChrX:103042413 | c.454-314T>G | NM_000533.3 | |
| PMM2 | Chr16:8891573 | NM_000303.2 | ||
| PMM2 | Chr16:8898599 | c.179-25A>G | NM_000303.2 | rs760689221 |
| PMM2 | Chr16:8926102 | c.640-15479C>T | NM_000303.2 | rs1258107584 |
| PMM2 | Chr16:8941558 | c.640-23A>G | NM_000303.2 | |
| PPT1 | Chr1:40539203 | c.*526_*529delATCA | NM_000310.3 | rs386833624 |
| PPT1 | Chr1:40558194 | c.125-15T>G | NM_000310.3 | rs386833629 |
| RMRP | Chr9:35658026 | NR_003051.3 | rs781730798 | |
| RMRP | Chr9:35658026 | NR_003051.3 | ||
| RMRP | Chr9:35658026 | NR_003051.3 | ||
| RMRP | Chr9:35658026 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | rs727502775 | |
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658028 | NR_003051.3 | ||
| RMRP | Chr9:35658028 | NR_003051.3 | ||
| RMRP | Chr9:35658029 | NR_003051.3 | ||
| RMRP | Chr9:35658029 | NR_003051.3 | ||
| RMRP | Chr9:35658032 | NR_003051.3 | ||
| RNASEH2B | Chr13:51501530 | c.65-13G>A | NM_024570.3 | |
| RNASEH2B | Chr13:51519550 | c.511-13G>A | NM_024570.3 | |
| RPGR | ChrX:38128234 | NM_000328.2 | ||
| RPGR | ChrX:38160137 | c.1059+363G>A | NM_001034853.1 | |
| SLC19A3 | Chr2:228560811 | c.980-14A>G | NM_025243.3 | rs200542114 |
| SLC26A2 | Chr5:149340544 | c.-26+2T>C | NM_000112.3 | rs386833492 |
| SLC26A4 | Chr7:107301201 | c.-103T>C | NM_000441.1 | rs60284988 |
| SLC26A4 | Chr7:107301244 | c.-60A>G | NM_000441.1 | rs545973091 |
| SLC26A4 | Chr7:107301301 | c.-4+1G>C | NM_000441.1 | |
| SLC26A4 | Chr7:107301305 | c.-4+5G>A | NM_000441.1 | rs727503425 |
| SLC26A4 | Chr7:107323842 | c.918+45_918+47delCAA | NM_000441.1 | |
| SLC26A4 | Chr7:107330533 | c.1150-35_1150-28delTTTGTAGG | NM_000441.1 | |
| SLC26A4 | Chr7:107334836 | c.1264-12T>A | NM_000441.1 | |
| SLC26A4 | Chr7:107336364 | c.1438-7dupT | NM_000441.1 | rs754734032 |
| SLC26A4 | Chr7:107341513 | c.1708-27_1708-11delTAAGTAACTTGACATTT | NM_000441.1 | |
| SLC26A4 | Chr7:107350439 | c.2090-52_2090-49delCAAA | NM_000441.1 | |
| SMPD1 | Chr11:6415102 | c.1341-21_1341-18delAATG | NM_000543.4 | rs1312743513 |
| TPP1 | Chr11:6637752 | c.887-18A>G | NM_000391.3 | |
| TYR | Chr11:88960973 | c.1037-18T>G | NM_000372.4 | |
| USH2A | Chr1:215821092 | c.14583-20C>G | NM_206933.2 | |
| USH2A | Chr1:215967783 | c.9959-4159A>G | NM_206933.2 | |
| USH2A | Chr1:216039721 | c.8845+628C>T | NM_206933.2 | |
| USH2A | Chr1:216064540 | c.7595-2144A>G | NM_206933.2 | rs786200928 |
| USH2A | Chr1:216247476 | c.5573-834A>G | NM_206933.2 | |
| USH2A | Chr1:216592035 | c.486-14G>A | NM_206933.2 | rs374536346 |
| USH2A | Chr1:216596610 | c.-259G>T | NM_206933.2 | |
| XPC | Chr3:14187285 | c.*156G>A | NM_004628.4 | rs121965092 |
| XPC | Chr3:14209904 | c.413-24A>G | NM_004628.4 | rs794729657 |
Test Strengths
The strengths of this test include:
-CAP-accredited laboratory
-CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
-Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
-Careful construction of clinically effective and scientifically justified gene panels
-Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
-Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
-~2,000 noncoding disease-causing variants in our clinical grade NGS assay for panels (please see ‘Noncoding disease-causing variants covered by this panel’ in the Panel Content section)
-Our rigorous variant classification scheme
-Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
-Our comprehensive clinical statements
The strengths of this test include:
- CAP-accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods, and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Our Nucleus online portal provides transparent and easy access to quality and performance data at the patient level
- Our publicly available analytic validation demonstrates complete details of test performance
- ~2,000 non-coding disease-causing variants in our clinical-grade NGS assay for panels (please see ‘Non-coding disease-causing variants covered by this test’)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enables accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: KIAA0586 NM_001244189.2:6,33, MCPH1 NM_001322042.2:14, PCCB NM_001178014.2:4. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
The coding regions of HBA1 and HBA2 are identical and the mapping of short reads from next-generation sequencing (NGS) data relies purely on differences in the intronic regions and/or the UTR. This reduces sensitivity for detecting variants in these regions when using standard NGS methods. However, the Blueprint Genetics custom assay has good coverage (>20x) with improved mapping rates (mapping quality >40) within the target regions of these genes. In addition, our validation showed deep mean depth of coverage. We have been able to detect sequence variants and some of the known disease-associated deletions using our assay; however, there may be reduced sensitivity to detect variants in these genes (including gene fusions and some deletions).
The number of CGG repeats will be reported when an allele is within the intermediate range (45–54 repeats) or the premutation range (55–200 repeats).
If a heterozygous premutation allele is identified, we will report on the presence or absence of AGG interruptions. The number of AGG repeats is not reported as our testing method cannot determine this. If desired, additional testing at another laboratory is recommended when AGG interruptions are present.
Full mutation alleles (greater than 200 repeats) are reported as >200 CGG repeats, without providing an exact count. Methylation studies are not performed in our laboratory.
The number of repeats is not provided for an allele within the normal range (5-44 repeats). If both alleles are within the normal range (5-44 repeats), we do not comment or provide a specific number of repeats on the report.
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Small deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.
The genes on the panels have been carefully selected based on scientific literature, mutation databases, and our experience.
The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis includes a combination of both sequence variants (single nucleotide variants (SNV’s) and indels) as well as deletions and duplications (copy number variants (CNV)).
Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter paper cards).
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.
| Sensitivity % (TP/(TP+FN) | Specificity % | |||
|---|---|---|---|---|
| GIAB Version 3.3.2 | GIAB Version 4.2.1 | GIAB Version 3.3.2 | GIAB Version 4.2.1 | |
| Single nucleotide variants | 99.57 % | 97.58 % | 100 % | 100 % |
| Insertions, deletions | ||||
| 1-10 bps | 95.38 % | 95.13 % | 100.00 % | 100.00 % |
| 11-20 bps | 99.09 % | 98.15 % | 100.00 % | 100.00 % |
| 21-50 bps | 98.78 % | 98.85 % | 100.00 % | 100.00 % |
| 2-50 bps | 97.62 % | 97.41 % | 100.00 % | 100.00 % |
| Copy number variants (exon level dels/dups, clinical sample performance) | Sensitivity | Specificity | ||
| 1 exon level deletion (heterozygous) | 100% (14/14) | NA | ||
| 1 exon deletion (homozygous or hemizygous) | 100% (5/5) | NA | ||
| 2-4 exon deletion (heterozygous or homozygous) | 100% (17/17) | NA | ||
| 5-33 exon deletion (heterozygous) | 100% (12/12) | NA | ||
| 1-5 exon duplication (heterozygous or homozygous) | 77% (10/13) | NA | ||
| 9-31 exon duplication (heterozygous) | 100% (7/7) | NA | ||
| Simulated CNV detection in reference samples (n=10) | Sensitivity | |||
| 5 exon level deletion/duplication | 98 % | |||
| Microdeletion/-duplication syndromes (large CNVs, n=22)) | ||||
| Size range (0.1-47 Mb) | 100% (22/22) | |||
| The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||||
| Average of median sequencing depths in reference samples | 136x | |||
| Nucleotides with >20x sequencing coverage (%) | 99.77% | |||
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
| ANALYTIC VALIDATION (reference samples; n=4) | Sensitivity % | |||
| Single nucleotide variants | ||||
| Heteroplasmic (45-100%) | 100.0% (50/50) | |||
| Heteroplasmic (35-45%) | 100.0% (87/87) | |||
| Heteroplasmic (25-35%) | 100.0% (73/73) | |||
| Heteroplasmic (15-25%) | 100.0% (74/74) | |||
| Heteroplasmic (5-15%) | 100.0% (79/79) | |||
| Heteroplasmic (<5%) | 53.3 % (8/15) | |||
| CLINICAL VALIDATION (n=20 samples) | ||||
| Single nucleotide variants (n=18 SNVs) | 100.0% (3/3) | |||
| Heteroplasmic (10-15%) | 100.0% (5/5) | |||
| Heteroplasmic (5-10%) | 100.0% (5/5) | |||
| Heteroplasmic (<5%) | 20% (1/5) | |||
| Insertions and deletions by sequence analysis (n=3) | ||||
| Heteroplasmic (45-100%) 1-10bp | 100.0% (3/3) | |||
| Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations) | ||||
| Insertions and deletions 1-24 bps by sequence analysis; n=17 | ||||
| Homoplasmic (100%) 1-24bp | 100.0% (17/17) | |||
| Heteroplasmic (50%) | 100.0% (17/17) | |||
| Heteroplasmic (25%) | 100.0% (17/17) | |||
| Heteroplasmic (20%) | 100.0% (17/17) | |||
| Heteroplasmic (15%) | 100.0% (17/17) | |||
| Heteroplasmic (10%) | 94.1% (16/17) | |||
| Heteroplasmic (5%) | 94.1% (16/17) | |||
| Copy number variants (separate artifical mutations; n=1500) | ||||
| Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | |||
| Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | |||
| Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238) | ||||
| Mean of medians | ||||
| Mean sequencing depth MQ0 | 6334x | |||
| Nucleotides with >1000x MQ0 sequencing coverage (%) | 100% | |||
| rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation | 12X | |||
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with the most comprehensive report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists prepare the report by assessing the pathogenicity of the identified variants. Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics.
Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.
Our screening panel report includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the report includes descriptions of the variant and its association with disease. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis, or in proactive testing, to confer a risk of developing an inherited disease. In reproductive screening, identification of single pathogenic or likely pathogenic variants in genes related to recessive disorders is considered as a carriership. Disease risk of potential offspring depends on whether both parents have a pathogenic or likely pathogenic variant in the same gene. Reproductive risk related to X-linked disorders may be difficult to estimate due to the possibility of skewed X-chromosome inactivation. Genetic counseling is recommended whenever pathogenic or likely pathogenic variants are reported.
Reporting focuses on high-quality variants that meet our stringent NGS quality metrics for a true positive call but they are not confirmed with alternative methods. Ordering healthcare professionals should consider further confirmation of the reported variants using a diagnostic test.
Other
- Expanded carrier screening: counseling and considerations
- Screening for autosomal recessive and X-linked conditions during pregnancy and preconception: a practice resource of the American College of Medical Genetics and Genomics (ACMG)
- Clinical validity and utility of preconception expanded carrier screening for the management of reproductive genetic risk in IVF and general population
- Carrier screening for genetic conditions. Committee Opinion No. 691. American College of Obstetricians and Gynecologists