Core Proactive Screen
Is a 107 gene test for healthy adults who want information about their genetic predisposition for developing life-threatening diseases that can be monitored or even prevented before an individual develops symptoms, such as cardiovascular disease or cancer.
- PLUS
Summary
The Blueprint Genetics Core Proactive Screen (test code PS0006):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
The Core Proactive Screen testing is for healthy adult individuals interested in learning about their genetic risk of developing certain conditions that can be monitored or even prevented before symptoms appear. After a positive result, healthcare provider can help their patient to make informed decisions about lifestyle choices or taking preventive actions.
Proactive Screen tests are for healthy adults who understand the pros and cons of proactive testing, thus these tests do not include genes that cause childhood conditions or conditions that lead to a recognizable phenotype.
These tests are for personal risk assessment of healthy individuals. Individuals with a family history of a hereditary disorder should have testing with the appropriate diagnostic panel instead of a Proactive Screen test.
All the genes on the Core Proactive Screen test are included on the Comprehensive Proactive Screen test. However, the Core Proactive Screen test contains only the most contributory genes where the clinical presentation is well-understood and the penetrance (likelihood that someone with a variant will develop symptoms) is high. For instance, the test does not include genes that cause classic Ehlers Danlos syndrome since cardiac involvement is rare in the classic form. HFE- associated hemochromatosis is not included as only approximately 10% of individuals who are homozygous for the most penetrant variant will develop the condition. This test does contain thrombosis susceptibility genes because the global health burden is significant even if the penetrance is not high.
The Core Proactive Screen test includes screening for
-A number of genes related mostly to increased risk of cancer, cardiovascular, pulmonary and hematological disorders with established management and intervention recommendations to prevent or reduce morbidity and mortality
-57 of 78 genes in the ACMG 3.1 SF list (PMID: 35802134)
-Aminoglycoside hearing loss (MT-RNR1)
Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.
Genes in the Core Proactive Screen and their clinical significance
To view complete table content, scroll horizontally.
| Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
|---|---|---|---|---|
| ACTA2 | Aortic aneurysm, familial thoracic, Moyamoya disease, Multisystemic smooth muscle dysfunction syndrome | AD | 20 | 76 |
| ANKRD26 | Thrombocytopenia | AD | 6 | 21 |
| APC | Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis | AD | 773 | 1926 |
| APOB | Hypobetalipoproteinemia, Hypercholesterolemia | AD/AR | 69 | 306 |
| ATM | Breast cancer, Ataxia-Telangiectasia | AD/AR | 1047 | 1109 |
| AXIN2 | Oligodontia-colorectal cancer syndrome, Oligondontia, isolated | AD | 19 | 18 |
| BAP1 | Tumor predisposition syndrome, Neurodevelopmental disorder | AD | 74 | 113 |
| BMPR1A* | Polyposis, juvenile intestinal | AD | 110 | 140 |
| BMPR2 | Pulmonary hypertension, primary, Pulmonary venoocclusive disease | AD | 391 | 572 |
| BRCA1* | Pancreatic cancer, Breast-ovarian cancer, familial, Fanconi anemia | AD/AR | 2997 | 2631 |
| BRCA2 | Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial | AD/AR | 3369 | 2659 |
| BRIP1 | Fanconi anemia, Ovarian cancer, familial | AD/AR | 238 | 189 |
| CDH1 | CDH1-related cancer, Blepharocheilodontic syndrome 1 | AD | 178 | 242 |
| CDK4 | Melanoma, cutaneous malignant | AD | 4 | 14 |
| CDKN2A | Melanoma, familial, Melanoma-pancreatic cancer syndrome | AD | 87 | 232 |
| CEBPA | Acute myeloid leukemia, familial | AD | 15 | 13 |
| COL3A1 | Ehlers-Danlos syndrome | AD | 520 | 631 |
| DES | Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Scapuloperoneal syndrome, neurogenic, Kaeser type | AD/AR | 64 | 124 |
| DICER1* | DICER1 syndrome | AD | 197 | 137 |
| DMD | Becker muscular dystrophy, Duchenne muscular dystrophy, Dilated cardiomyopathy (DCM) | XL | 832 | 3915 |
| DSG2 | Arrhythmogenic right ventricular dysplasia, Dilated cardiomyopathy (DCM) | AD/AR | 44 | 129 |
| DSP | Cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis, Arrhythmogenic right ventricular dysplasia, familial, Cardiomyopathy, dilated, with wooly hair and keratoderma, Keratosis palmoplantaris striata II, Epidermolysis bullosa, lethal acantholytic | AD/AR | 177 | 296 |
| EGFR | Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial | AD/AR | 55 | 18 |
| EMD | Emery-Dreifuss muscular dystrophy | XL | 48 | 113 |
| EPCAM | Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis | AD/AR | 38 | 80 |
| ERCC6L2 | Bone marrow failure syndrome 2 | AR | 4 | 9 |
| ETV6 | Thrombocytopenia 5 | AD | 10 | 38 |
| F5 | Factor V deficiency, Thrombophilia due to activated protein C resistance | AD/AR | 19 | 157 |
| FBN1 | MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 2 | AD | 1465 | 2679 |
| FH | Hereditary leiomyomatosis and renal cell cancer, Fumarase deficiency | AD/AR | 178 | 207 |
| FHL1* | Myopathy with postural muscle atrophy, Emery-Dreifuss muscular dystrophy, Reducing bod myopathy | XL | 26 | 62 |
| FLCN | Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous | AD | 154 | 210 |
| FLNC* | Myopathy, Cardiomyopathy | AD | 54 | 109 |
| GATA2 | Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency | AD | 30 | 142 |
| GLA | Fabry disease | XL | 226 | 937 |
| HOXB13 | Familial prostate cancer | AD | 1 | 5 |
| KCNH2 | Short QT syndrome, Long QT syndrome | AD | 371 | 933 |
| KCNQ1 | Short QT syndrome, Long QT syndrome, Atrial fibrillation, Jervell and Lange-Nielsen syndrome | AD/AR | 298 | 631 |
| KIT | Gastrointestinal stromal tumor, Piebaldism | AD | 79 | 116 |
| LAMP2 | Danon disease | XL | 62 | 101 |
| LDLR | Hypercholesterolemia | AD/AR | 1719 | 2180 |
| LMNA | Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type | AD/AR | 250 | 564 |
| MAX | Pheochromocytoma | AD | 13 | 31 |
| MEN1 | Hyperparathyroidism, familial primary, Multiple endocrine neoplasia | AD | 263 | 730 |
| MLH1 | Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 873 | 1191 |
| MSH2 | Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome | AD/AR | 933 | 1249 |
| MSH6 | Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 672 | 586 |
| MT-RNR1 | Deafness, mitochondrial | Mitochondrial | 3 | |
| MUTYH | Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas | AR | 134 | 168 |
| MYBPC3 | Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) | AD | 482 | 1048 |
| MYH11 | Aortic aneurysm, familial thoracic | AD/AR | 16 | 48 |
| MYH7 | Hypertrophic cardiomyopathy (HCM), Myopathy, myosin storage, Myopathy, distal, Dilated cardiomyopathy (DCM) | AD | 305 | 986 |
| MYL2 | Hypertrophic cardiomyopathy (HCM), Infantile type I muscle fibre disease and cardiomyopathy | AD/AR | 21 | 67 |
| MYL3 | Hypertrophic cardiomyopathy (HCM) | AD/AR | 12 | 41 |
| NBN | Breast cancer, Nijmegen breakage syndrome | AR | 188 | 97 |
| NF1* | Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome | AD | 1157 | 2901 |
| NF2 | Schwannomatosis, Neurofibromatosis | AD | 66 | 433 |
| NTHL1 | Familial adenomatous polyposis 3 | AR | 7 | 3 |
| PALB2 | Fanconi anemia, Pancreatic cancer, Breast cancer | AD/AR | 495 | 406 |
| PDGFRA# | Gastrointestinal stromal tumor | AD | 22 | 19 |
| PKP2#* | Arrhythmogenic right ventricular dysplasia | AD | 150 | 289 |
| PLN | Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) | AD/AR | 8 | 30 |
| POLD1 | Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency | AD/AR | 3 | 31 |
| POLE | Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) | AD/AR | 8 | 70 |
| POT1 | Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 | AD | 2 | 34 |
| PRKAG2 | Hypertrophic cardiomyopathy (HCM), Wolff-Parkinson-White syndrome, Glycogen storage disease of heart, lethal congenital | AD | 19 | 57 |
| PRKAR1A | Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex | AD | 75 | 183 |
| PROC | Thrombophilia, hereditary | AD/AR | 36 | 387 |
| PROS1* | Thrombophilia, hereditary | AD/AR | 23 | 416 |
| PTCH1 | Basal cell nevus syndrome | AD | 193 | 522 |
| PTEN* | Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome | AD | 435 | 638 |
| RAD51C | Fanconi anemia, Breast-ovarian cancer, familial | AD/AR | 107 | 125 |
| RAD51D | Breast-ovarian cancer, familial | AD | 77 | 78 |
| RB1 | Retinoblastoma | AD | 266 | 1102 |
| RBM20 | Dilated cardiomyopathy (DCM) | AD | 19 | 47 |
| RECQL* | Breast cancer | AD | 9 | 27 |
| RET | Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia | AD | 122 | 407 |
| RHBDF2 | Tylosis with esophageal cancer | AD | 2 | 4 |
| RUNX1 | Platelet disorder, familial, with associated myeloid malignancy | AD | 47 | 101 |
| RYR2 | Ventricular tachycardia, catecholaminergic polymorphic, Arrhythmogenic right ventricular dysplasia | AD | 124 | 372 |
| SCN5A | Heart block, nonprogressive, Heart block, progressive, Long QT syndrome, Ventricular fibrillation, Atrial fibrillation, Sick sinus syndrome, Brugada syndrome, Dilated cardiomyopathy (DCM) | AD/AR/Digenic | 234 | 899 |
| SDHAF2 | Paragangliomas | AD | 4 | 5 |
| SDHB | Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome | AD/AR | 151 | 272 |
| SDHC | Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas | AD | 29 | 60 |
| SDHD# | Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency | AD | 68 | 170 |
| SERPINA1 | Alpha-1-antitrypsin deficiency | AR | 49 | 80 |
| SERPINC1 | Antithrombin III deficiency | AD/AR | 44 | 412 |
| SMAD4 | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia | AD | 179 | 143 |
| SMARCB1 | Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 | AD | 36 | 118 |
| STK11 | Peutz-Jeghers syndrome | AD | 173 | 460 |
| SUFU | Medulloblastoma, Basal cell nevus syndrome | AD | 22 | 44 |
| TGFB2 | Loeys-Dietz syndrome | AD | 36 | 38 |
| TGFB3 | Loeys-Dietz syndrome (Reinhoff syndrome), Arrhythmogenic right ventricular dysplasia | AD | 19 | 26 |
| TGFBR1 | Loeys-Dietz syndrome | AD | 40 | 69 |
| TGFBR2 | Loeys-Dietz syndrome | AD | 58 | 139 |
| TINF2 | Revesz syndrome, Dyskeratosis congenita | AD | 25 | 42 |
| TMEM43 | Arrhythmogenic right ventricular dysplasia, Emery-Dreifuss muscular dystrophy | AD | 4 | 24 |
| TNNI3 | Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Dilated cardiomyopathy (DCM) | AD/AR | 56 | 129 |
| TNNT2 | Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Dilated cardiomyopathy (DCM) | AD | 61 | 148 |
| TP53 | Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma | AD | 393 | 505 |
| TPM1 | Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) | AD | 34 | 98 |
| TSC1 | Lymphangioleiomyomatosis, Tuberous sclerosis | AD | 177 | 372 |
| TSC2 | Lymphangioleiomyomatosis, Tuberous sclerosis | AD | 396 | 1195 |
| TTN* | Dilated cardiomyopathy (DCM), Tibial muscular dystrophy, Limb-girdle muscular dystrophy, Hereditary myopathy with early respiratory failure, Myopathy, early-onset, with fatal cardiomyopathy (Salih myopathy), Muscular dystrophy, limb-girdle, type 2J | AD/AR | 818 | 327 |
| TTR | Dystransthyretinemic hyperthyroxinemia, Amyloidosis, hereditary, transthyretin-related | AD | 52 | 148 |
| VHL | Erythrocytosis, familial, Pheochromocytoma, Von Hippel-Lindau disease | AD/AR | 206 | 614 |
| WT1 | Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 | AD | 42 | 183 |
The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
Some, or all, of the gene is duplicated in the genome. Read more.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Core Proactive Screen
To view complete table content, scroll horizontally.
| Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
|---|---|---|---|---|
| ANKRD26 | Chr10:27389371 | c.-116C>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389373 | c.-118C>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389374 | c.-119C>A/G | NM_014915.2 | |
| ANKRD26 | Chr10:27389374 | c.-119C>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389376 | c.-121A>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389380 | c.-127_-126delAT | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389389 | c.-134G>A | NM_014915.2 | rs863223318 |
| APC | Chr5:112043009-112043595 | |||
| APC | Chr5:112043220 | c.-195A>C | NM_001127511.2 | |
| APC | Chr5:112043223 | c.-192A>G/T | NM_001127511.2 | |
| APC | Chr5:112043223 | c.-192A>G | NM_001127511.2 | rs879253784 |
| APC | Chr5:112043223 | c.-192A>T | NM_001127511.2 | |
| APC | Chr5:112043224 | c.-191T>C | NM_001127511.2 | |
| APC | Chr5:112043225 | c.-190G>A | NM_001127511.2 | |
| APC | Chr5:112043289 | c.-125delA | NM_001127511.2 | |
| APC | Chr5:112072710-112073585 | |||
| APC | Chr5:112111314 | c.423-12A>G | NM_000038.5 | |
| APC | Chr5:112111315 | c.423-11A>G | NM_000038.5 | |
| APC | Chr5:112115546 | c.532-941G>A | NM_000038.5 | rs730881227 |
| APC | Chr5:112151175 | c.835-17A>G | NM_000038.5 | |
| APC | Chr5:112158419 | c.1408+731C>T | NM_000038.5 | |
| APC | Chr5:112158423 | c.1408+735A>T | NM_000038.5 | |
| ATM | Chr11:108093770 | c.-174A>G | NM_000051.3 | |
| ATM | Chr11:108094508 | c.-31+595G>A | NM_000051.3 | |
| ATM | Chr11:108098321 | c.-30-1G>T | NM_000051.3 | rs869312754 |
| ATM | Chr11:108138753 | c.2639-384A>G | NM_000051.3 | |
| ATM | Chr11:108141209 | c.2839-579_2839-576delAAGT | NM_000051.3 | |
| ATM | Chr11:108151710 | c.3403-12T>A | NM_000051.3 | rs201370733 |
| ATM | Chr11:108158168 | c.3994-159A>G | NM_000051.3 | rs864622543 |
| ATM | Chr11:108164028 | c.4612-12A>G | NM_000051.3 | |
| ATM | Chr11:108179837 | c.5763-1050A>G | NM_000051.3 | rs774925473 |
| ATM | Chr11:108214779 | c.8418+681A>G | NM_000051.3 | rs748635985 |
| BAP1 | Chr3:52435659 | c.*644delG | NM_004656.3 | |
| BMPR2 | Chr2:203241251 | c.-947_-946delGCinsAT | NM_001204.6 | rs1085307144 |
| BMPR2 | Chr2:203241851 | c.-347C>T | NM_001204.6 | |
| BMPR2 | Chr2:203241919 | c.-279C>A | NM_001204.6 | |
| BMPR2 | Chr2:203242106 | c.-92C>A | NM_001204.6 | |
| BMPR2 | Chr2:203395505 | c.968-12T>G | NM_001204.6 | |
| BRCA1 | Chr17:41196352 | c.*1340_*1342delTGT | NM_007294.3 | rs1281551853 |
| BRCA1 | Chr17:41196424 | c.*1271T>C | NM_007294.3 | |
| BRCA1 | Chr17:41197167 | c.*528G>C | NM_007294.3 | rs1060504556 |
| BRCA1 | Chr17:41197588 | c.*103_*106delTGTC | NM_007294.3 | rs431825382 |
| BRCA1 | Chr17:41197637 | c.*58C>T | NM_007294.3 | rs137892861 |
| BRCA1 | Chr17:41197859 | c.5468-40T>A | NM_007294.3 | rs80358151 |
| BRCA1 | Chr17:41199745 | c.5407-25T>A | NM_007294.3 | rs758780152 |
| BRCA1 | Chr17:41201232 | c.5333-36_5333-22delTACTGCAGTGATTTT | NM_007294.3 | |
| BRCA1 | Chr17:41206122 | c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG | NM_007294.3 | |
| BRCA1 | Chr17:41209164 | c.5194-12G>A | NM_007294.3 | rs80358079 |
| BRCA1 | Chr17:41215994 | c.5075-27delA | NM_007294.3 | |
| BRCA1 | Chr17:41251909 | c.442-22_442-13delTGTTCTTTAC | NM_007294.3 | rs879254224 |
| BRCA1 | Chr17:41256984 | c.213-11T>G | NM_007294.3 | rs80358061 |
| BRCA1 | Chr17:41256985 | c.213-12A>G | NM_007294.3 | rs80358163 |
| BRCA1 | Chr17:41256988 | c.213-15A>G | NM_007294.3 | |
| BRCA1 | Chr17:41276134 | c.-19-2A>G | NM_007294.3 | |
| BRCA2 | Chr13:32889805 | c.-40+1G>A | NM_000059.3 | |
| BRCA2 | Chr13:32890469 | c.-39-89delC | NM_000059.3 | |
| BRCA2 | Chr13:32890556 | c.-39-1_-39delGA | NM_000059.3 | rs758732038 |
| BRCA2 | Chr13:32890558 | c.-39-1G>A | NM_000059.3 | rs1060499566 |
| BRCA2 | Chr13:32900222 | c.426-12_426-8delGTTTT | NM_000059.3 | rs276174844 |
| BRCA2 | Chr13:32945079 | c.8488-14A>G | NM_000059.3 | |
| BRCA2 | Chr13:32953872 | c.8954-15T>G | NM_000059.3 | |
| BRCA2 | Chr13:32971007 | c.9502-28A>G | NM_000059.3 | rs397508059 |
| BRCA2 | Chr13:32971023 | c.9502-12T>G | NM_000059.3 | rs81002803 |
| BRIP1 | Chr17:59858864 | c.1629-498A>T | NM_032043.2 | |
| CDH1 | Chr16:68842843 | c.687+92T>A | NM_004360.3 | |
| CDKN2A | Chr9:21968346 | c.458-105A>G | NM_000077.4 | |
| CDKN2A | Chr9:21973573 | c.150+1104C>A | NM_000077.4 | rs756102261 |
| CDKN2A | Chr9:21974401 | c.*73+2T>G | NM_058197.4 | |
| CDKN2A | Chr9:21974847 | c.-21C>T | NM_000077.4 | |
| CDKN2A | Chr9:21974875 | c.-49C>A | NM_000077.4 | rs1064797383 |
| CDKN2A | Chr9:21974882 | c.-56G>T | NM_000077.4 | |
| CDKN2A | Chr9:21974916 | c.-93_-91delAGG | NM_000077.4 | |
| COL3A1 | Chr2:189872183 | c.3256-43T>G | NM_000090.3 | rs587779667 |
| DICER1 | Chr14:95559038 | c.5364+1187T>G | NM_177438.2 | |
| DMD | ChrX:31165653 | c.10554-18C>G | NM_004006.2 | |
| DMD | ChrX:31200680 | c.9974+175T>A | NM_004006.2 | |
| DMD | ChrX:31224814 | c.9564-30A>T | NM_004006.2 | |
| DMD | ChrX:31225211 | c.9564-427T>G | NM_004006.2 | |
| DMD | ChrX:31226400 | c.9563+1215A>G | NM_004006.2 | |
| DMD | ChrX:31229031 | c.9362-1215A>G | NM_004006.2 | |
| DMD | ChrX:31241047 | c.9361+117A>G | NM_004006.2 | |
| DMD | ChrX:31279293 | c.9225-160A>G | NM_004006.2 | |
| DMD | ChrX:31279418 | c.9225-285A>G | NM_004006.2 | |
| DMD | ChrX:31279420 | c.9225-287C>A | NM_004006.2 | |
| DMD | ChrX:31279780 | c.9225-647A>G | NM_004006.2 | rs398124091 |
| DMD | ChrX:31279781 | c.9225-648A>G | NM_004006.2 | rs398124084 |
| DMD | ChrX:31332523 | c.9224+9192C>A | NM_004006.2 | |
| DMD | ChrX:31382270 | c.9085-15519G>T | NM_004006.2 | |
| DMD | ChrX:31613687 | c.8217+32103G>T | NM_004006.2 | |
| DMD | ChrX:31627738 | c.8217+18052A>G | NM_004006.2 | |
| DMD | ChrX:31697714 | c.7661-11T>C | NM_004006.2 | |
| DMD | ChrX:31983146 | c.6614+3310G>T | NM_004006.2 | rs797045526 |
| DMD | ChrX:32305833 | c.6118-15A>G | NM_004006.2 | |
| DMD | ChrX:32360414 | c.5740-15G>T | NM_004006.2 | |
| DMD | ChrX:32366860 | c.5326-215T>G | NM_004006.2 | |
| DMD | ChrX:32379144 | c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA | NM_004006.2 | |
| DMD | ChrX:32398808 | c.4675-11A>G | NM_004006.2 | |
| DMD | ChrX:32460274 | c.3787-843C>A | NM_004006.2 | |
| DMD | ChrX:32470726 | c.3603+2053G>C | NM_004006.2 | |
| DMD | ChrX:32479316 | c.3432+2240A>G | NM_004006.2 | |
| DMD | ChrX:32479520 | c.3432+2036A>G | NM_004006.2 | |
| DMD | ChrX:32669100 | c.961-5831C>T | NM_004006.2 | rs398124099 |
| DMD | ChrX:32669194 | c.961-5925A>C | NM_004006.2 | |
| DMD | ChrX:32716130 | c.832-15A>G | NM_004006.2 | rs72470513 |
| DMD | ChrX:32827744 | c.531-16T>A/G | NM_004006.2 | |
| DMD | ChrX:32827744 | c.531-16T>A | NM_004006.2 | |
| DMD | ChrX:32827744 | c.531-16T>G | NM_004006.2 | |
| DMD | ChrX:32841967 | c.265-463A>G | NM_004006.2 | |
| DMD | ChrX:33032666 | c.93+5590T>A | NM_004006.2 | |
| DMD | ChrX:33192452 | c.31+36947G>A | NM_004006.2 | |
| DMD | ChrX:33229483 | c.-54T>A | NM_004006.2 | |
| EMD | ChrX:153608559 | c.266-27_266-10delTCTGCTACCGCTGCCCCC | NM_000117.2 | |
| EPCAM | Chr2:47606078 | c.556-14A>G | NM_002354.2 | rs376155665 |
| F5 | Chr1:169494158 | c.5717-12T>A | NM_000130.4 | |
| F5 | Chr1:169521527 | c.1296+268A>G | NM_000130.4 | |
| F5 | Chr1:169521984 | c.1119-12C>G | NM_000130.4 | |
| FBN1 | Chr15:48707358 | c.8051+375G>T | NM_000138.4 | |
| FBN1 | Chr15:48720682 | c.6872-14A>G | NM_000138.4 | |
| FBN1 | Chr15:48721629 | c.6872-961A>G | NM_000138.4 | |
| FBN1 | Chr15:48739106 | c.5672-87A>G | NM_000138.4 | |
| FBN1 | Chr15:48739107 | c.5672-88A>G | NM_000138.4 | |
| FBN1 | Chr15:48764885 | c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT | NM_000138.4 | |
| FBN1 | Chr15:48786466 | c.2678-15C>A | NM_000138.4 | |
| FBN1 | Chr15:48802380 | c.1589-14A>G | NM_000138.4 | |
| FBN1 | Chr15:48818478 | c.863-26C>T | NM_000138.4 | |
| GATA2 | Chr3:128202131 | c.1017+572C>T | NM_032638.4 | |
| GATA2 | Chr3:128202162 | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | NM_032638.4 | |
| GATA2 | Chr3:128202171 | c.1017+532T>A | NM_032638.4 | |
| GLA | ChrX:100653945 | c.640-11T>A | NM_000169.2 | |
| GLA | ChrX:100654735 | c.640-801G>A | NM_000169.2 | rs199473684 |
| GLA | ChrX:100654793 | c.640-859C>T | NM_000169.2 | rs869312374 |
| GLA | ChrX:100656225 | c.547+395G>C | NM_000169.2 | |
| KCNH2 | Chr7:150646165 | c.2399-28A>G | NM_000238.3 | |
| KCNQ1 | Chr11:2484803 | rs2074238 | ||
| LDLR | Chr19:11199939 | NM_000527.4 | ||
| LDLR | Chr19:11199958 | c.-267A>G | NM_000527.4 | |
| LDLR | Chr19:11199997 | c.-228G>C | NM_000527.4 | rs376713337 |
| LDLR | Chr19:11200000 | NM_000527.4 | ||
| LDLR | Chr19:11200019 | c.-206C>T | NM_000527.4 | rs549995837 |
| LDLR | Chr19:11200031 | NM_000527.4 | rs1270618112 | |
| LDLR | Chr19:11200032 | NM_000527.4 | rs879254362 | |
| LDLR | Chr19:11200032 | NM_000527.4 | ||
| LDLR | Chr19:11200034 | c.-191C>A | NM_000527.4 | |
| LDLR | Chr19:11200037 | c.-188C>T | NM_000527.4 | |
| LDLR | Chr19:11200038 | c.-185_-183delCTT | NM_000527.4 | |
| LDLR | Chr19:11200053 | c.-172G>A | NM_000527.4 | |
| LDLR | Chr19:11200057 | c.-168A>G | NM_000527.4 | |
| LDLR | Chr19:11200062 | c.-163T>C | NM_000527.4 | |
| LDLR | Chr19:11200064 | c.-161A>C | NM_000527.4 | |
| LDLR | Chr19:11200069 | c.-156C>T | NM_000527.4 | |
| LDLR | Chr19:11200069 | c.-155_-154delACinsTTCTGCAAACTCCT | NM_000527.4 | |
| LDLR | Chr19:11200069 | c.-155_-150delACCCCA | NM_000527.4 | |
| LDLR | Chr19:11200070 | c.-155_-154delACinsTTCTGCAAACTCCT | NM_000527.4 | rs879254365 |
| LDLR | Chr19:11200070 | c.-155_-150delACCCCAinsTT | NM_000527.4 | |
| LDLR | Chr19:11200071 | c.-154C>T | NM_000527.4 | |
| LDLR | Chr19:11200072 | c.-153C>T | NM_000527.4 | |
| LDLR | Chr19:11200073 | c.-152C>T | NM_000527.4 | |
| LDLR | Chr19:11200074 | c.-151C>G | NM_000527.4 | |
| LDLR | Chr19:11200075 | c.-150A>G | NM_000527.4 | |
| LDLR | Chr19:11200076 | c.-149C>A | NM_000527.4 | |
| LDLR | Chr19:11200079 | c.-146C>A | NM_000527.4 | |
| LDLR | Chr19:11200083 | c.-142C>G/T | NM_000527.4 | |
| LDLR | Chr19:11200084 | c.-139_-130delCTCCCCCTGC | NM_000527.4 | |
| LDLR | Chr19:11200085 | c.-140C>A/G/T | NM_000527.4 | rs875989887 |
| LDLR | Chr19:11200086 | c.-139C>A/G | NM_000527.4 | |
| LDLR | Chr19:11200086 | c.-138delT | NM_000527.4 | rs387906307 |
| LDLR | Chr19:11200087 | c.-138T>C | NM_000527.4 | |
| LDLR | Chr19:11200088 | c.-137C>T | NM_000527.4 | |
| LDLR | Chr19:11200089 | c.-136C>G/T | NM_000527.4 | |
| LDLR | Chr19:11200089 | c.-136C>G | NM_000527.4 | rs879254374 |
| LDLR | Chr19:11200089 | c.-136C>T | NM_000527.4 | |
| LDLR | Chr19:11200090 | c.-135C>G | NM_000527.4 | |
| LDLR | Chr19:11200091 | c.-134C>T | NM_000527.4 | |
| LDLR | Chr19:11200098 | c.-124dupA | NM_000527.4 | |
| LDLR | Chr19:11200105 | c.-120C>T | NM_000527.4 | rs875989886 |
| LDLR | Chr19:11200124 | c.-101T>C | NM_000527.4 | rs747068848 |
| LDLR | Chr19:11200126 | c.-99A>G | NM_000527.4 | |
| LDLR | Chr19:11200127 | c.-98C>T | NM_000527.4 | |
| LDLR | Chr19:11200202 | c.-23A>C | NM_000527.4 | rs763282380 |
| LDLR | Chr19:11200202 | c.-22delC | NM_000527.4 | rs879254379 |
| LDLR | Chr19:11200211 | c.-14C>A | NM_000527.4 | |
| LDLR | Chr19:11218203 | c.940+14delC | NM_000527.4 | rs879254730 |
| LDLR | Chr19:11221315 | c.941-13T>A | NM_000527.4 | |
| LDLR | Chr19:11224179 | c.1359-31_1359-23delGCGCTGATGinsCGGCT | NM_000527.4 | |
| LDLR | Chr19:11224186 | c.1359-25A>G | NM_000527.4 | |
| LDLR | Chr19:11227685 | c.1845+11C>G | NM_000527.4 | |
| LDLR | Chr19:11227689 | c.1845+15C>A | NM_000527.4 | |
| LDLR | Chr19:11231284 | c.2140+86C>G | NM_000527.4 | |
| LDLR | Chr19:11231301 | c.2140+103G>T | NM_000527.4 | |
| LDLR | Chr19:11242035 | c.*43G>A | NM_000527.4 | rs879254527 |
| LMNA | Chr1:156100609 | c.513+45T>G | NM_170707.3 | |
| LMNA | Chr1:156105681 | c.937-11C>G | NM_170707.3 | rs267607645 |
| LMNA | Chr1:156107037 | c.1608+14G>A | NM_170707.3 | |
| LMNA | Chr1:156107433 | c.1609-12T>G | NM_170707.3 | rs267607582 |
| MEN1 | Chr11:64571394 | c.*412G>A | NM_000244.3 | |
| MEN1 | Chr11:64575165 | c.670-15_670-14delTC | NM_000244.3 | |
| MEN1 | Chr11:64577602 | c.-23-11_-22delTTGCCTTGCAGGC | NM_000244.3 | |
| MEN1 | Chr11:64577603 | c.-23_-22insT | NM_000244.3 | |
| MEN1 | Chr11:64577626 | c.-23-22C>A | NM_000244.3 | |
| MLH1 | Chr3:37034619 | c.-413_-411delGAG | NM_000249.3 | rs953169437 |
| MLH1 | Chr3:37034932 | c.-107C>G | NM_000249.3 | rs587778886 |
| MLH1 | Chr3:37034976 | c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA | NM_000249.3 | |
| MLH1 | Chr3:37034997 | c.-42C>T | NM_000249.3 | rs41285097 |
| MLH1 | Chr3:37035012 | c.-27C>A | NM_000249.3 | rs587779001 |
| MLH1 | Chr3:37035260 | c.116+106G>A | NM_000249.3 | |
| MLH1 | Chr3:37038099 | c.117-11T>A | NM_000249.3 | rs267607711 |
| MLH1 | Chr3:37050292 | c.454-13A>G | NM_000249.3 | rs267607749 |
| MLH1 | Chr3:37061788 | c.885-9_887dupTCCTGACAGTTT | NM_000249.3 | rs63751620 |
| MLH1 | Chr3:37070436 | c.1558+13T>A | NM_000249.3 | rs267607834 |
| MSH2 | Chr2:47630106 | c.-225G>C | NM_000251.2 | rs138068023 |
| MSH2 | Chr2:47630150 | c.-181G>A | NM_000251.2 | rs786201698 |
| MSH2 | Chr2:47630249 | c.-81dupA | NM_000251.2 | rs560991330,rs587779187 |
| MSH2 | Chr2:47630251 | c.-78_-77delTG | NM_000251.2 | rs587779182 |
| MSH2 | Chr2:47698086 | c.1662-17dupG | NM_000251.2 | rs587779099 |
| MSH6 | Chr2:48018295 | c.457+33_457+34insGTGT | NM_000179.2 | |
| MSH6 | Chr2:48030536 | c.3173-16_3173-5delCCCTCTCTTTTA | NM_000179.2 | |
| MSH6 | Chr2:48034014 | c.*15A>C | NM_000179.2 | |
| MSH6 | Chr2:48034047 | c.*49_*68dupTTCAGACAACATTATGATCT | NM_000179.2 | rs777409019 |
| MUTYH | Chr1:45797534 | c.998-13T>G | NM_001128425.1 | |
| MUTYH | Chr1:45798558 | c.504+19_504+31delTAGGGGAAATAGG | NM_001128425.1 | rs781222233 |
| MYBPC3 | Chr11:47353394 | c.*26+2T>C | NM_000256.3 | |
| MYBPC3 | Chr11:47353821 | c.3628-12C>G | NM_000256.3 | rs371428751 |
| MYBPC3 | Chr11:47359371 | c.2309-26A>G | NM_000256.3 | |
| MYBPC3 | Chr11:47360310 | c.2149-80G>A | NM_000256.3 | |
| MYBPC3 | Chr11:47364709 | c.1227-13G>A | NM_000256.3 | rs397515893 |
| MYBPC3 | Chr11:47364832 | c.1224-19G>A | NM_000256.3 | rs587776699 |
| MYBPC3 | Chr11:47364865 | c.1224-52G>A | NM_000256.3 | rs786204336 |
| MYBPC3 | Chr11:47365750 | c.1091-575A>C | NM_000256.3 | |
| MYBPC3 | Chr11:47367305 | c.1090+453C>T | NM_000256.3 | |
| MYBPC3 | Chr11:47368602 | c.906-22G>A | NM_000256.3 | rs756267771 |
| MYBPC3 | Chr11:47368616 | c.906-36G>A | NM_000256.3 | rs864622197 |
| NF1 | Chr17:29422055 | c.-273A>C | NM_001042492.2 | |
| NF1 | Chr17:29422056 | c.-272G>A | NM_001042492.2 | |
| NF1 | Chr17:29431417 | c.60+9031_60+9035delAAGTT | NM_001042492.2 | |
| NF1 | Chr17:29475515 | c.61-7486G>T | NM_001042492.2 | |
| NF1 | Chr17:29488136 | c.288+2025T>G | NM_001042492.2 | |
| NF1 | Chr17:29508426 | c.587-14T>A | NM_001042492.2 | |
| NF1 | Chr17:29508428 | c.587-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29510334 | c.888+651T>A | NM_001042492.2 | |
| NF1 | Chr17:29510427 | c.888+744A>G | NM_001042492.2 | |
| NF1 | Chr17:29510472 | c.888+789A>G | NM_001042492.2 | |
| NF1 | Chr17:29527428 | c.889-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29530107 | c.1260+1604A>G | NM_001042492.2 | |
| NF1 | Chr17:29533239 | c.1261-19G>A | NM_001042492.2 | |
| NF1 | Chr17:29534143 | c.1392+754T>G | NM_001042492.2 | |
| NF1 | Chr17:29540877 | c.1393-592A>G | NM_001042492.2 | |
| NF1 | Chr17:29542762 | c.1527+1159C>T | NM_001042492.2 | |
| NF1 | Chr17:29548419 | c.1642-449A>G | NM_001042492.2 | rs863224655 |
| NF1 | Chr17:29549489 | c.*481A>G | NM_001128147.2 | |
| NF1 | Chr17:29553439 | c.2002-14C>G | NM_001042492.2 | |
| NF1 | Chr17:29554225 | c.2252-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29556025 | c.2410-18C>G | NM_001042492.2 | |
| NF1 | Chr17:29556027 | c.2410-16A>G | NM_001042492.2 | |
| NF1 | Chr17:29556028 | c.2410-15A>G | NM_001042492.2 | |
| NF1 | Chr17:29556031 | c.2410-12T>G | NM_001042492.2 | |
| NF1 | Chr17:29556839 | c.2851-14_2851-13insA | NM_001042492.2 | |
| NF1 | Chr17:29557267 | c.2991-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29563299 | c.3974+260T>G | NM_001042492.2 | |
| NF1 | Chr17:29577082 | c.4110+945A>G | NM_001042492.2 | |
| NF1 | Chr17:29580296 | c.4173+278A>G | NM_001042492.2 | |
| NF1 | Chr17:29588708 | c.4578-20_4578-18delAAG | NM_001042492.2 | |
| NF1 | Chr17:29588715 | c.4578-14T>G | NM_001042492.2 | |
| NF1 | Chr17:29654479 | c.5269-38A>G | NM_001042492.2 | |
| NF1 | Chr17:29656858 | c.5610-456G>T | NM_001042492.2 | |
| NF1 | Chr17:29657848 | c.5812+332A>G | NM_001042492.2 | rs863224491 |
| NF1 | Chr17:29661577 | c.5813-279A>G | NM_001042492.2 | |
| NF1 | Chr17:29664375 | c.6428-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29664618 | c.6642+18A>G | NM_001042492.2 | |
| NF1 | Chr17:29676126 | c.7190-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29676127 | c.7190-11_7190-10insGTTT | NM_001042492.2 | |
| NF1 | Chr17:29685177 | c.7971-321C>G | NM_001042492.2 | |
| NF1 | Chr17:29685481 | c.7971-17C>G | NM_001042492.2 | |
| NF1 | Chr17:29685665 | c.8113+25A>T | NM_001042492.2 | |
| NF2 | Chr22:30050946 | c.516+232G>A | NM_000268.3 | |
| PALB2 | Chr16:23649285 | c.109-12T>A | NM_024675.3 | rs774949203 |
| PDGFRA | Chr4:55161473 | c.*34G>A | NM_006206.4 | rs552950826 |
| PLN | Chr6:118869382 | c.-271A>G | NM_002667.4 | |
| PLN | Chr6:118869417 | c.-236C>G | NM_002667.4 | rs188578681 |
| POLE | Chr12:133249181 | c.1686+32C>G | NM_006231.2 | rs762985435 |
| PRKAR1A | Chr17:66508599 | c.-97G>A | NM_002734.4 | |
| PRKAR1A | Chr17:66508689 | c.-7G>A | NM_002734.4 | |
| PRKAR1A | Chr17:66508690 | c.-7+1G>A | NM_002734.4 | |
| PRKAR1A | Chr17:66521878 | c.550-17T>A | NM_002734.4 | |
| PRKAR1A | Chr17:66523964 | c.709-7_709-2delTTTTTA | NM_002734.4 | rs281864801 |
| PROC | Chr2:128175983 | c.-107A>G | NM_000312.3 | |
| PROC | Chr2:128175984 | c.-106A>G | NM_000312.3 | |
| PROC | Chr2:128175988 | c.-102T>A | NM_000312.3 | |
| PROC | Chr2:128175991 | NM_000312.3 | ||
| PROC | Chr2:128175994 | c.-96T>G | NM_000312.3 | |
| PROC | Chr2:128176001 | c.-89T>C | NM_000312.3 | |
| PROC | Chr2:128176005 | c.-85C>T | NM_000312.3 | |
| PROC | Chr2:128176047 | c.-43A>C | NM_000312.3 | |
| PROC | Chr2:128176058 | c.-32G>A | NM_000312.3 | rs912629007 |
| PROC | Chr2:128179040 | c.237+15G>A | NM_000312.3 | rs528055589 |
| PROC | Chr2:128180582 | c.263-28T>G | NM_000312.3 | |
| PROC | Chr2:128180823 | c.401-18_401-3delGCCCTCCCCTGCCCGC | NM_000312.3 | |
| PROC | Chr2:128183562 | c.536-99C>G | NM_000312.3 | |
| PROC | Chr2:128186595 | c.*73C>T | NM_000312.3 | rs199469473 |
| PROS1 | Chr3:93593261 | c.1871-20_1871-13delCTAATATT | NM_000313.3 | |
| PROS1 | Chr3:93593263 | c.1871-14T>G | NM_000313.3 | rs754929347 |
| PROS1 | Chr3:93598175 | c.1493-17T>C | NM_000313.3 | rs199469501 |
| PROS1 | Chr3:93605147 | c.1323+33A>G | NM_000313.3 | |
| PROS1 | Chr3:93611983 | c.966-17C>G | NM_000313.3 | rs199469490 |
| PROS1 | Chr3:93692761 | c.-168C>T | NM_000313.3 | rs199469484 |
| PROS1 | Chr3:93692783 | c.-190C>G | NM_000313.3 | rs149028936 |
| PTCH1 | Chr9:98226337 | c.2561-2057A>G | NM_000264.3 | |
| PTEN | Chr10:89622883-89623482 | |||
| PTEN | Chr10:89622988 | c.-1239A>G | NM_000314.6 | |
| PTEN | Chr10:89623049 | c.-1178C>T | NM_000314.6 | |
| PTEN | Chr10:89623056 | c.-1171C>T | NM_000314.6 | rs587779981 |
| PTEN | Chr10:89623116 | c.-1111A>G | NM_000314.6 | |
| PTEN | Chr10:89623226 | c.-1001T>C | NM_000314.4 | |
| PTEN | Chr10:89623296 | c.-931G>A | NM_000314.4 | rs587781959 |
| PTEN | Chr10:89623306 | c.-921G>T | NM_000314.4 | |
| PTEN | Chr10:89623331 | c.-896T>C | NM_000314.4 | |
| PTEN | Chr10:89623365 | c.-862G>T | NM_000314.4 | rs587776675 |
| PTEN | Chr10:89623373 | c.-854C>G | NM_000314.4 | |
| PTEN | Chr10:89623392 | c.-835C>T | NM_000314.4 | rs587779994 |
| PTEN | Chr10:89623428 | c.-799G>C | NM_000314.4 | rs587779992 |
| PTEN | Chr10:89623462 | c.-765G>A | NM_000314.4 | |
| PTEN | Chr10:89690791 | c.210-8dupT | NM_000314.4 | |
| PTEN | Chr10:89692749 | c.254-21G>C | NM_000314.4 | |
| PTEN | Chr10:89725294 | c.*65T>A | NM_000314.4 | |
| PTEN | Chr10:89725304 | c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG | NM_000314.4 | |
| RB1 | Chr13:48877814 | NM_000321.2 | rs576931877 | |
| RB1 | Chr13:48877836 | NM_000321.2 | ||
| RB1 | Chr13:48877837 | c.-212G>A | NM_000321.2 | |
| RB1 | Chr13:48877851 | c.-198G>A | NM_000321.2 | rs387906521 |
| RB1 | Chr13:48877851 | c.-198G>T | NM_000321.2 | |
| RB1 | Chr13:48877852 | c.-197G>A | NM_000321.2 | |
| RB1 | Chr13:48877853 | NM_000321.2 | ||
| RB1 | Chr13:48877856 | c.-193T>A/G | NM_000321.2 | |
| RB1 | Chr13:48877856 | NM_000321.2 | ||
| RB1 | Chr13:48877856 | NM_000321.2 | ||
| RB1 | Chr13:48877857 | c.-192G>A | NM_000321.2 | |
| RB1 | Chr13:48877860 | c.-189G>T | NM_000321.2 | rs387906520 |
| RB1 | Chr13:48877899 | c.-150G>C | NM_000321.2 | |
| RB1 | Chr13:48877900 | c.-149G>T | NM_000321.2 | |
| RB1 | Chr13:48921946 | c.501-15T>G | NM_000321.2 | |
| RB1 | Chr13:48930735 | c.608-3418A>G | NM_000321.2 | |
| RB1 | Chr13:48937921 | c.861+828T>G | NM_000321.2 | |
| RB1 | Chr13:48947691 | c.1215+63T>G | NM_000321.2 | |
| RB1 | Chr13:48954175 | c.1390-14A>G | NM_000321.2 | rs9535023 |
| RB1 | Chr13:48954239 | c.1421+20_1421+33delTAAAAAATTTTTTT | NM_000321.2 | |
| RB1 | Chr13:49027115 | c.1696-14C>T | NM_000321.2 | rs776912915 |
| RB1 | Chr13:49027117 | c.1696-12T>G | NM_000321.2 | |
| RB1 | Chr13:49030329 | c.1815-11A>G | NM_000321.2 | |
| RB1 | Chr13:49039121 | c.2212-13T>A | NM_000321.2 | |
| RB1 | Chr13:49039327 | c.2326-14T>C | NM_000321.2 | |
| RB1 | Chr13:49046098 | c.2490-1398A>G | NM_000321.2 | |
| RB1 | Chr13:49047468 | c.2490-28T>C | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>C/G/T | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>C | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>T | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>G | NM_000321.2 | |
| RET | Chr10:43572670 | c.-37G>C | NM_020975.4 | rs751005619 |
| RET | Chr10:43572680 | c.-27C>G | NM_020975.4 | |
| RET | Chr10:43582162 | c.73+9385_73+9395delAGCAACTGCCA | NM_020975.4 | rs368137511 |
| RET | Chr10:43606948 | c.1522+35C>T | NM_020975.4 | rs377130948 |
| RET | Chr10:43612192 | c.2284+13C>T | NM_020975.4 | |
| RET | Chr10:43612198 | c.2284+19C>T | NM_020975.4 | |
| RET | Chr10:43613947 | c.2392+19T>C | NM_020975.4 | rs778745375 |
| RYR2 | Chr1:237730106 | c.3423+32dupG | NM_001035.2 | |
| SCN5A | Chr3:38639469 | c.2024-11T>A | NM_198056.2 | rs777987317 |
| SCN5A | Chr3:38691021 | c.-53+1G>A | NM_198056.2 | |
| SERPINA1 | Chr14:94854894 | c.-5+2dupT | NM_000295.4 | |
| SERPINA1 | Chr14:94854896 | c.-5+1G>A | NM_000295.4 | rs775786225 |
| SERPINC1 | Chr1:173876666 | c.1154-14G>A | NM_000488.3 | |
| SERPINC1 | Chr1:173884075 | c.42-18C>G | NM_000488.3 | |
| SERPINC1 | Chr1:173886568 | c.-171C>G | NM_000488.3 | |
| SMARCB1 | Chr22:24130008 | c.93+559A>G | NM_003073.3 | |
| SMARCB1 | Chr22:24176316 | c.1119-12C>G | NM_003073.3 | |
| SMARCB1 | Chr22:24176437 | c.*70C>T | NM_003073.3 | |
| SMARCB1 | Chr22:24176449 | c.*82C>T | NM_003073.3 | |
| STK11 | Chr19:1220520 | c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG | NM_000455.4 | |
| STK11 | Chr19:1220530 | c.598-32_597+31delGCCCCCTCCCGGGC | NM_000455.4 | |
| TGFB3 | Chr14:76425035 | c.*495C>T | NM_003239.2 | rs387906514 |
| TGFB3 | Chr14:76447266 | c.-30G>A | NM_003239.2 | rs770828281 |
| TGFBR2 | Chr3:30648317 | c.-59C>T | NM_001024847.2 | |
| TP53 | Chr17:7571520 | NM_000546.5 | ||
| TP53 | Chr17:7577647 | c.673-39G>A | NM_000546.5 | |
| TP53 | Chr17:7579601 | c.97-11C>G | NM_000546.5 | |
| TP53 | Chr17:7590694 | c.-29+1G>T | NM_000546.5 | |
| TPM1 | Chr15:63349172 | c.241-12_241-11delCTinsTG | NM_001018005.1 | rs199476309 |
| TSC1 | Chr9:135800306 | c.363+668G>A | NM_000368.4 | |
| TSC2 | Chr16:2106052 | c.600-145C>T | NM_000548.3 | |
| TSC2 | Chr16:2107460 | c.848+281C>T | NM_000548.3 | rs45517132 |
| TSC2 | Chr16:2110656 | c.976-15G>A | NM_000548.3 | rs45517150 |
| TSC2 | Chr16:2127477 | c.2838-122G>A | NM_000548.3 | |
| TSC2 | Chr16:2138031 | c.5069-18A>G | NM_000548.3 | rs45484794 |
| VHL | Chr3:10183453 | c.-75_-55delCGCACGCAGCTCCGCCCCGCG | NM_000551.3 | rs727503744 |
| VHL | Chr3:10183471 | c.-54_-44dupTCCGACCCGCG | NM_000551.3 | |
| VHL | Chr3:10191719 | c.*70C>A | NM_000551.3 | |
| VHL | Chr3:10191719 | c.*70C>T | NM_000551.3 | rs552290225 |
Test Strengths
The strengths of this test include:
- CAP-accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods, and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Our Nucleus online portal provides transparent and easy access to quality and performance data at the patient level
- Our publicly available analytic validation demonstrates complete details of test performance
- ~2,000 non-coding disease-causing variants in our clinical-grade NGS assay for panels (please see ‘Non-coding disease-causing variants covered by this test’)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enables accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
MT-RNR1: only the m.1555A>G (NC_012920.1) is reported
TTN: missense and in-frame indel variants are not reported
The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: PDGFRA NM_001347828.2:2, PKP2 NM_004572.4:6, SDHD NM_001276506.2:4. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low-level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low-level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Single exon deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease-causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing a molecular diagnosis.
The coding regions of HBA1 and HBA2 are identical and the mapping of short reads from next-generation sequencing (NGS) data relies purely on differences in the intronic regions and/or the UTR. This reduces sensitivity for detecting variants in these regions when using standard NGS methods. However, the Blueprint Genetics custom assay has good coverage (>20x) with improved mapping rates (mapping quality >40) within the target regions of these genes. In addition, our validation showed deep mean depth of coverage. We have been able to detect sequence variants and some of the known disease-associated deletions using our assay; however, there may be reduced sensitivity to detect variants in these genes (including gene fusions and some deletions).
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the test performance section.
Special reporting policies:
APC c.3920T>A, p.(Ile1307Lys) (NM_000038.6) is not reported because of conflicting evidence of pathogenicity across populations
MT-RNR1: only the m.1555A>G (NC_012920.1) is reported
TTN: missense and in-frame indel variants are not reported
The genes on the panels have been carefully selected based on scientific literature, mutation databases, and our experience.
The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis includes a combination of both sequence variants (single nucleotide variants (SNV’s) and indels) as well as deletions and duplications (copy number variants (CNV)).
Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter paper cards).
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.
| Sensitivity % (TP/(TP+FN) | Specificity % | |||
|---|---|---|---|---|
| GIAB Version 3.3.2 | GIAB Version 4.2.1 | GIAB Version 3.3.2 | GIAB Version 4.2.1 | |
| Single nucleotide variants | 99.57 % | 97.58 % | 100 % | 100 % |
| Insertions, deletions | ||||
| 1-10 bps | 95.38 % | 95.13 % | 100.00 % | 100.00 % |
| 11-20 bps | 99.09 % | 98.15 % | 100.00 % | 100.00 % |
| 21-50 bps | 98.78 % | 98.85 % | 100.00 % | 100.00 % |
| 2-50 bps | 97.62 % | 97.41 % | 100.00 % | 100.00 % |
| Copy number variants (exon level dels/dups, clinical sample performance) | Sensitivity | Specificity | ||
| 1 exon level deletion (heterozygous) | 100% (14/14) | NA | ||
| 1 exon deletion (homozygous or hemizygous) | 100% (5/5) | NA | ||
| 2-4 exon deletion (heterozygous or homozygous) | 100% (17/17) | NA | ||
| 5-33 exon deletion (heterozygous) | 100% (12/12) | NA | ||
| 1-5 exon duplication (heterozygous or homozygous) | 77% (10/13) | NA | ||
| 9-31 exon duplication (heterozygous) | 100% (7/7) | NA | ||
| Simulated CNV detection in reference samples (n=10) | Sensitivity | |||
| 5 exon level deletion/duplication | 98 % | |||
| Microdeletion/-duplication syndromes (large CNVs, n=22)) | ||||
| Size range (0.1-47 Mb) | 100% (22/22) | |||
| The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||||
| Average of median sequencing depths in reference samples | 136x | |||
| Nucleotides with >20x sequencing coverage (%) | 99.77% | |||
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
| ANALYTIC VALIDATION (reference samples; n=4) | Sensitivity % | |||
| Single nucleotide variants | ||||
| Heteroplasmic (45-100%) | 100.0% (50/50) | |||
| Heteroplasmic (35-45%) | 100.0% (87/87) | |||
| Heteroplasmic (25-35%) | 100.0% (73/73) | |||
| Heteroplasmic (15-25%) | 100.0% (74/74) | |||
| Heteroplasmic (5-15%) | 100.0% (79/79) | |||
| Heteroplasmic (<5%) | 53.3 % (8/15) | |||
| CLINICAL VALIDATION (n=20 samples) | ||||
| Single nucleotide variants (n=18 SNVs) | 100.0% (3/3) | |||
| Heteroplasmic (10-15%) | 100.0% (5/5) | |||
| Heteroplasmic (5-10%) | 100.0% (5/5) | |||
| Heteroplasmic (<5%) | 20% (1/5) | |||
| Insertions and deletions by sequence analysis (n=3) | ||||
| Heteroplasmic (45-100%) 1-10bp | 100.0% (3/3) | |||
| Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations) | ||||
| Insertions and deletions 1-24 bps by sequence analysis; n=17 | ||||
| Homoplasmic (100%) 1-24bp | 100.0% (17/17) | |||
| Heteroplasmic (50%) | 100.0% (17/17) | |||
| Heteroplasmic (25%) | 100.0% (17/17) | |||
| Heteroplasmic (20%) | 100.0% (17/17) | |||
| Heteroplasmic (15%) | 100.0% (17/17) | |||
| Heteroplasmic (10%) | 94.1% (16/17) | |||
| Heteroplasmic (5%) | 94.1% (16/17) | |||
| Copy number variants (separate artifical mutations; n=1500) | ||||
| Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | |||
| Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | |||
| Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238) | ||||
| Mean of medians | ||||
| Mean sequencing depth MQ0 | 6334x | |||
| Nucleotides with >1000x MQ0 sequencing coverage (%) | 100% | |||
| rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation | 12X | |||
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with the most comprehensive report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists prepare the report by assessing the pathogenicity of the identified variants. Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics.
Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.
Our screening panel report includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the report includes descriptions of the variant and its association with disease. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis, or in proactive testing, to confer a risk of developing an inherited disease. In reproductive screening, identification of single pathogenic or likely pathogenic variants in genes related to recessive disorders is considered as a carriership. Disease risk of potential offspring depends on whether both parents have a pathogenic or likely pathogenic variant in the same gene. Reproductive risk related to X-linked disorders may be difficult to estimate due to the possibility of skewed X-chromosome inactivation. Genetic counseling is recommended whenever pathogenic or likely pathogenic variants are reported.
Reporting focuses on high-quality variants that meet our stringent NGS quality metrics for a true positive call but they are not confirmed with alternative methods. Ordering healthcare professionals should consider further confirmation of the reported variants using a diagnostic test.
Other
- ACMG SF v3.1 list for reporting of secondary findings in clinical exome and genome sequencing: A policy statement of the American College of Medical Genetics and Genomics (ACMG)
- Physician-directed genetic screening to evaluate personal risk for medically actionable disorders: a large multi-center cohort study
- Aortic Dissection Association Scandinavia
- Ashley EA et al. Genetics and cardiovascular disease: a policy statement from the American Heart Association. Circulation. 2012 Jul 3;126(1):142-57.
- Boodhwani M et al. Canadian Cardiovascular Society position statement on the management of thoracic aortic disease. Can J Cardiol. 2014 Jun;30(6):577-89.
- Erbel R et al. 2014 ESC Guidelines on the diagnosis and treatment of aortic diseases: Document covering acute and chronic aortic diseases of the thoracic and abdominal aorta of the adult. Eur Heart J. 2014 Nov 1;35(41):2873-926.
- GeneReviews - Arterial Tortuosity Syndrome
- GeneReviews - Loeys-Dietz Syndrome
- GeneReviews - Marfan Syndrome
- GeneReviews - Shprintzen-Goldberg Syndrome
- GeneReviews - Thoracic Aortic Aneurysms and Aortic Dissections
- GeneReviews - Vascular Ehlers-Danlos Syndrome
- Genetic Aortic Disorders Association Canada
- Hiratzka LF et al. 2010 ACCF/AHA/AATS/ACR/ASA/SCA/SCAI/SIR/STS/SVM guidelines for the diagnosis and management of patients with Thoracic Aortic Disease: Circulation. 2010 Apr 6;121(13):e266-369
- Loeys-Dietz Syndrome Foundation
- Marfan Association UK
- Marfan Foundation
- NORD - Arterial Tortuosity Syndrome
- NORD - Ehlers Danlos Syndrome
- NORD - Marfan Syndrome
- Tinkle BT et al. Health supervision for children with Marfan syndrome. Pediatrics. 2013 Oct;132(4):e1059-72.
- Al-Khatib SM et al. 2017 AHA/ACC/HRS Guideline for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death. Circulation. 2017 Oct 30 [Epub ahead of print].
- British Heart Foundation
- British Heart Foundation - Brugada
- GeneReviews - ARVC
- GeneReviews - Brugada Syndrome
- GeneReviews - Long QT Syndrome
- Ingles J et al. Genetic testing for inherited heart diseases: longitudinal impact on health-related quality of life. Genet Med. 2012 May 3.
- NORD - Brugada
- Philips B et al. 2015 update on the diagnosis and management of arrhythmogenic right ventricular cardiomyopathy. Curr Opin Cardiol. 2016 Jan;31(1):46-56.
- SADS Foundation
- Sudden Cardiac Arrest Foundation
- American Foundation for Cardiomyopathy
- Bozkurt B et al. Current Diagnostic and Treatment Strategies for Specific Dilated Cardiomyopathies: A Scientific Statement From the American Heart Association. Circulation. 2016 Dec 6;134(23):e579-e646.
- Cardiomyopathy Association Australia
- Cardiomyopathy UK
- GeneReviews - DCM
- GeneReviews - HCM
- Gersh BJ et al. 2011 ACCF/AHA Guideline for the Diagnosis and Treatment of Hypertrophic Cardiomyopathy. J Am Coll Cardiol. 2011 Dec 13;58(25):e212-60.
- FH Foundation
- FH diagnosis and treatment - The FH Foundation
- Familial Hypercholesterolemia Foundation
- Familial hypercholesterolaemia: identification and management by National Institute for Health and Care Excellence
- GeneReviews - Familial Hypercholesterolemia
- American Cancer Society
- Canadian Cancer Society
- GeneReviews - BRCA1 and BRCA2 Hereditary Breast and Ovarian Cancer
- GeneReviews - BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer
- Fighting Hereditary Breast and Ovarian Cancer
- GeneReviews - Lynch Syndrome