Comprehensive Cardiology Screen

Summary

Is a 95 gene test for healthy adults who want information about their genetic risk of developing cardiovascular diseases that can be monitored or even prevented before symptoms appear.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
95
Test code
PS0001
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Comprehensive Cardiology Screen (test code PS0001):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

The Comprehensive Cardiology Screen test is for healthy adults interested in learning about their genetic risk of developing certain cardiovascular diseases that can be monitored or even prevented before symptoms appear. After receiving a positive result, healthcare provider can help their patient to make informed decisions about lifestyle choices or taking preventive action.

These tests are for personal risk assessment of healthy individuals. Individuals with a family history of a hereditary disorder should have testing with the appropriate diagnostic panel instead of a Proactive Screen test.

The Comprehensive Cardiology Screen test includes screening for
-All genes related to cardiovascular disorders listed in ACMG 3.1 SF (PMID: 35802134)
-Many other relevant genes related to:
-Cardiomyopathy (HCM, DCM, ARVC)
-Channelopathies (LQTS, Brugada, CPVT)
-Dyslipidemia (FH)
-Vascular conditions (aortic disease, Marfan syndrome, Loeys-Dietz syndrome, Ehlers Danlos syndrome (EDS) types 1,2 and 4, Liddle syndrome)
-Pulmonary conditions (pulmonary arterial hypertension (PAH), hereditary hemorrhagic telangiectasia (HHT), bronchiectasis, pulmonary fibrosis, alpha-1 antitrypsin deficiency, emphysema)
-Thrombophilia (F5 Leiden variant; susceptibility to deep vein thrombosis/pulmonary embolism)
-Bleeding tendency (F5: only bi-allelic loss-of-function variants are reported)
-Other: Maturity onset diabetes of young (MODY), hereditary hemochromatosis

Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.

Genes in the Comprehensive Cardiology Screen and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ACTA2 Aortic aneurysm, familial thoracic, Moyamoya disease, Multisystemic smooth muscle dysfunction syndrome AD 20 76
ACTC1 Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Atrial septal defect, Dilated cardiomyopathy (DCM) AD 23 63
ACTN2 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 11 44
ACVRL1 Hereditary hemorrhagic telangiectasia AD 140 430
APOB Hypobetalipoproteinemia, Hypercholesterolemia AD/AR 69 306
BAG3 Dilated cardiomyopathy (DCM), Myopathy, myofibrillar AD 39 62
BMPR2 Pulmonary hypertension, primary, Pulmonary venoocclusive disease AD 391 572
CACNA1C* Brugada syndrome, Timothy syndrome, Neurodevelopmental disorder AD 19 68
CALM1* Ventricular tachycardia, catecholaminergic polymorphic, Recurrent cardiac arrest, infantile, Long QT syndrome AD 10 10
CALM2 Long QT syndrome AD 8 10
CALM3 Catecholaminergic polymorphic ventricular tachycardia AD/AR 4 4
CASQ2 Ventricular tachycardia, catecholaminergic, polymorphic AD/AR 24 34
CASZ1 Dilated cardiomyopathy (DCM), Ventricular septal defect AD 3 2
CAV1 Partial lipodystrophy, congenital cataracts, and neurodegeneration syndrome, Lipodystrophy, congenital generalized, Pulmonary hypertension, primary 3 AD/AR 7 11
CHRM2 Dilated cardiomyopathy (DCM) AD/AR 1
COL3A1 Ehlers-Danlos syndrome AD 520 631
COL5A1 Ehlers-Danlos syndrome AD 101 154
COL5A2 Ehlers-Danlos syndrome AD 24 35
CSRP3 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 4 30
DES Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Scapuloperoneal syndrome, neurogenic, Kaeser type AD/AR 64 124
DMD Becker muscular dystrophy, Duchenne muscular dystrophy, Dilated cardiomyopathy (DCM) XL 832 3915
DSC2 Arrhythmogenic right ventricular dysplasia with palmoplantar keratoderma and woolly hair, Arrhythmogenic right ventricular dysplasia AD/AR 32 87
DSG2 Arrhythmogenic right ventricular dysplasia, Dilated cardiomyopathy (DCM) AD/AR 44 129
DSP Cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis, Arrhythmogenic right ventricular dysplasia, familial, Cardiomyopathy, dilated, with wooly hair and keratoderma, Keratosis palmoplantaris striata II, Epidermolysis bullosa, lethal acantholytic AD/AR 177 296
EMD Emery-Dreifuss muscular dystrophy XL 48 113
ENG Hereditary hemorrhagic telangiectasia AD 158 491
F5 Factor V deficiency, Thrombophilia due to activated protein C resistance AD/AR 19 157
FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 2 AD 1465 2679
FHL1* Myopathy with postural muscle atrophy, Emery-Dreifuss muscular dystrophy, Reducing bod myopathy XL 26 62
FLNC* Myopathy, Cardiomyopathy AD 54 109
GAA Glycogen storage disease AR 193 573
GATA4* Tetralogy of Fallot, Atrioventricular septal defect, Testicular anomalies with or without congenital heart disease, Ventricular septal defect, Atrial septal defect AD 37 140
GDF2 Hereditary hemorrhagic telangiectasia, type 5, Pulmonary arterial hypertension (PAH) AD 3 17
GLA Fabry disease XL 226 937
HCN4 Sick sinus syndrome, Brugada syndrome, Left ventricular non-compaction cardiomyopathy (LVNC) AD 8 34
HFE Hemochromatosis AR/Digenic 11 56
HNF1A Maturity onset diabetes of the young AD 78 528
JUP Arrhythmogenic right ventricular dysplasia, Naxos disease AD/AR 8 46
KCNE1 Long QT syndrome, Jervell and Lange-Nielsen syndrome AD/AR/Digenic 11 46
KCNE2 Long QT syndrome, Atrial fibrillation, familial AD 5 24
KCNH2 Short QT syndrome, Long QT syndrome AD 371 933
KCNJ2 Short QT syndrome, Andersen syndrome, Long QT syndrome, Atrial fibrillation AD 41 93
KCNQ1 Short QT syndrome, Long QT syndrome, Atrial fibrillation, Jervell and Lange-Nielsen syndrome AD/AR 298 631
LAMP2 Danon disease XL 62 101
LDLR Hypercholesterolemia AD/AR 1719 2180
LDLRAP1 Hypercholesterolemia AR 10 23
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type AD/AR 250 564
LMOD2 Familial dilated cardiomyopathy AR
MYBPC3 Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 482 1048
MYH11 Aortic aneurysm, familial thoracic AD/AR 16 48
MYH7 Hypertrophic cardiomyopathy (HCM), Myopathy, myosin storage, Myopathy, distal, Dilated cardiomyopathy (DCM) AD 305 986
MYL2 Hypertrophic cardiomyopathy (HCM), Infantile type I muscle fibre disease and cardiomyopathy AD/AR 21 67
MYL3 Hypertrophic cardiomyopathy (HCM) AD/AR 12 41
MYLK* Aortic aneurysm, familial thoracic 7 AD 16 28
NEXN Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AR 6 43
NKX2-5 Conotruncal heart malformations, Hypothyroidism, congenital nongoitrous,, Atrial septal defect, Ventricular septal defect 3, Conotruncal heart malformations, variable, Tetralogy of Fallot AD 45 108
PCSK9 Hypercholesterolemia AD 29 89
PKP2#* Arrhythmogenic right ventricular dysplasia AD 150 289
PLN Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD/AR 8 30
PRKAG2 Hypertrophic cardiomyopathy (HCM), Wolff-Parkinson-White syndrome, Glycogen storage disease of heart, lethal congenital AD 19 57
PRKG1 Aortic aneurysm, familial thoracic 8 AD 2 3
PROC Thrombophilia, hereditary AD/AR 36 387
PROS1* Thrombophilia, hereditary AD/AR 23 416
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 45 53
RBM20 Dilated cardiomyopathy (DCM) AD 19 47
RYR2 Ventricular tachycardia, catecholaminergic polymorphic, Arrhythmogenic right ventricular dysplasia AD 124 372
SCN5A Heart block, nonprogressive, Heart block, progressive, Long QT syndrome, Ventricular fibrillation, Atrial fibrillation, Sick sinus syndrome, Brugada syndrome, Dilated cardiomyopathy (DCM) AD/AR/Digenic 234 899
SCNN1B Liddle syndrome, Pseudohypoaldosteronism, Bronchiectasis with or without elevated sweat chloride AD/AR 19 47
SCNN1G Liddle syndrome, Pseudohypoaldosteronism, Bronchiectasis with or without elevated sweat chloride AD/AR 8 20
SERPINA1 Alpha-1-antitrypsin deficiency AR 49 80
SERPINC1 Antithrombin III deficiency AD/AR 44 412
SGCD Muscular dystrophy, limb-girdle, Dilated cardiomyopathy (DCM) AR 21 27
SMAD3 Aneurysms-osteoarthritis syndrome, Loeys-Dietz syndrome AD 48 82
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMAD9 Pulmonary hypertension, primary 2 AD 4 17
TAB2 Congenital heart defects, multiple types, 2 AD 13 31
TBX20* Atrial septal defect 4 AD 4 28
TCAP Muscular dystrophy, limb-girdle, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD/AR 12 28
TECRL Ventricular tachycardia, catecholaminergic polymorphic, 3 AR 2 3
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
TGFB2 Loeys-Dietz syndrome AD 36 38
TGFB3 Loeys-Dietz syndrome (Reinhoff syndrome), Arrhythmogenic right ventricular dysplasia AD 19 26
TGFBR1 Loeys-Dietz syndrome AD 40 69
TGFBR2 Loeys-Dietz syndrome AD 58 139
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TMEM43 Arrhythmogenic right ventricular dysplasia, Emery-Dreifuss muscular dystrophy AD 4 24
TNNC1 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 9 24
TNNI3 Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Dilated cardiomyopathy (DCM) AD/AR 56 129
TNNT2 Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Dilated cardiomyopathy (DCM) AD 61 148
TPM1 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 34 98
TRDN Ventricular tachycardia, catecholaminergic polymorphic AR 19 6
TTN* Dilated cardiomyopathy (DCM), Tibial muscular dystrophy, Limb-girdle muscular dystrophy, Hereditary myopathy with early respiratory failure, Myopathy, early-onset, with fatal cardiomyopathy (Salih myopathy), Muscular dystrophy, limb-girdle, type 2J AD/AR 818 327
TTR Dystransthyretinemic hyperthyroxinemia, Amyloidosis, hereditary, transthyretin-related AD 52 148
VCL Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 8 30
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Cardiology Screen

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ACTC1 Chr15:35080829 c.*1784T>C NM_005159.4
ACVRL1 Chr12:52314269 c.1378-274C>G NM_000020.2
ACVRL1 Chr12:52314327 c.1378-216C>G NM_000020.2
ACVRL1 Chr12:52314387 c.1378-156_1378-155invCT NM_000020.2
ACVRL1 Chr12:52314412 c.1378-131C>G NM_000020.2
ACVRL1 Chr12:52314465 c.1378-78T>G NM_000020.2
ACVRL1 Chr12:52314474 c.1378-69C>A NM_000020.2
BMPR2 Chr2:203241251 c.-947_-946delGCinsAT NM_001204.6 rs1085307144
BMPR2 Chr2:203241851 c.-347C>T NM_001204.6
BMPR2 Chr2:203241919 c.-279C>A NM_001204.6
BMPR2 Chr2:203242106 c.-92C>A NM_001204.6
BMPR2 Chr2:203395505 c.968-12T>G NM_001204.6
CAV1 Chr7:116165023 c.-88delC NM_001753.4
COL3A1 Chr2:189872183 c.3256-43T>G NM_000090.3 rs587779667
COL5A1 Chr9:137645685 c.1720-11T>A NM_000093.4 rs863223444
COL5A1 Chr9:137680989 c.2647-12A>G NM_000093.4
COL5A1 Chr9:137686903 c.2701-25T>G NM_000093.4 rs765079080
COL5A1 Chr9:137726806 c.5137-11T>A NM_000093.4 rs183495554
COL5A2 Chr2:189927655 c.1924-11T>C NM_000393.3
DMD ChrX:31165653 c.10554-18C>G NM_004006.2
DMD ChrX:31200680 c.9974+175T>A NM_004006.2
DMD ChrX:31224814 c.9564-30A>T NM_004006.2
DMD ChrX:31225211 c.9564-427T>G NM_004006.2
DMD ChrX:31226400 c.9563+1215A>G NM_004006.2
DMD ChrX:31229031 c.9362-1215A>G NM_004006.2
DMD ChrX:31241047 c.9361+117A>G NM_004006.2
DMD ChrX:31279293 c.9225-160A>G NM_004006.2
DMD ChrX:31279418 c.9225-285A>G NM_004006.2
DMD ChrX:31279420 c.9225-287C>A NM_004006.2
DMD ChrX:31279780 c.9225-647A>G NM_004006.2 rs398124091
DMD ChrX:31279781 c.9225-648A>G NM_004006.2 rs398124084
DMD ChrX:31332523 c.9224+9192C>A NM_004006.2
DMD ChrX:31382270 c.9085-15519G>T NM_004006.2
DMD ChrX:31613687 c.8217+32103G>T NM_004006.2
DMD ChrX:31627738 c.8217+18052A>G NM_004006.2
DMD ChrX:31697714 c.7661-11T>C NM_004006.2
DMD ChrX:31983146 c.6614+3310G>T NM_004006.2 rs797045526
DMD ChrX:32305833 c.6118-15A>G NM_004006.2
DMD ChrX:32360414 c.5740-15G>T NM_004006.2
DMD ChrX:32366860 c.5326-215T>G NM_004006.2
DMD ChrX:32379144 c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA NM_004006.2
DMD ChrX:32398808 c.4675-11A>G NM_004006.2
DMD ChrX:32460274 c.3787-843C>A NM_004006.2
DMD ChrX:32470726 c.3603+2053G>C NM_004006.2
DMD ChrX:32479316 c.3432+2240A>G NM_004006.2
DMD ChrX:32479520 c.3432+2036A>G NM_004006.2
DMD ChrX:32669100 c.961-5831C>T NM_004006.2 rs398124099
DMD ChrX:32669194 c.961-5925A>C NM_004006.2
DMD ChrX:32716130 c.832-15A>G NM_004006.2 rs72470513
DMD ChrX:32827744 c.531-16T>A/G NM_004006.2
DMD ChrX:32827744 c.531-16T>A NM_004006.2
DMD ChrX:32827744 c.531-16T>G NM_004006.2
DMD ChrX:32841967 c.265-463A>G NM_004006.2
DMD ChrX:33032666 c.93+5590T>A NM_004006.2
DMD ChrX:33192452 c.31+36947G>A NM_004006.2
DMD ChrX:33229483 c.-54T>A NM_004006.2
DSC2 Chr18:28683379 c.-1445G>C NM_024422.4 rs75494355
EMD ChrX:153608559 c.266-27_266-10delTCTGCTACCGCTGCCCCC NM_000117.2
ENG Chr9:130578354 c.1742-22T>C NM_001114753.2
ENG Chr9:130588962 c.361-11T>A NM_001114753.2
ENG Chr9:130616692 c.-58G>A NM_001114753.2 rs971268057
ENG Chr9:130616761 c.-127C>T NM_001114753.2
ENG Chr9:130616776 c.-142A>T NM_001114753.2
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
GAA Chr17:78078341 c.-32-13T>G NM_000152.3 rs386834236
GAA Chr17:78078341 c.-32-13T>A NM_000152.3
GAA Chr17:78078351 c.-32-3C>A/G NM_000152.3
GAA Chr17:78078352 c.-32-2A>G NM_000152.3
GAA Chr17:78078353 c.-32-1G>C NM_000152.3
GAA Chr17:78078369 c.-17C>T NM_000152.3
GAA Chr17:78082266 c.1076-22T>G NM_000152.3 rs762260678
GAA Chr17:78090422 c.2190-345A>G NM_000152.3
GAA Chr17:78092432 c.2647-20T>G NM_000152.3
GATA4 Chr8:11561282 c.-989C>T NM_002052.3
GATA4 Chr8:11561369 c.-902G>T NM_002052.3
GATA4 Chr8:11561399 NM_002052.3 rs1195641788
GATA4 Chr8:11612500 c.910-55T>C NM_002052.3
GATA4 Chr8:11612745 c.997+103G>T NM_002052.3 rs113049875
GATA4 Chr8:11614418 c.998-26G>A NM_002052.3
GLA ChrX:100653945 c.640-11T>A NM_000169.2
GLA ChrX:100654735 c.640-801G>A NM_000169.2 rs199473684
GLA ChrX:100654793 c.640-859C>T NM_000169.2 rs869312374
GLA ChrX:100656225 c.547+395G>C NM_000169.2
HFE Chr6:26087649 c.-20G>A NM_000410.3 rs138378000
HNF1A Chr12:121416034 c.-538G>C NM_000545.5
HNF1A Chr12:121416110 c.-462G>A NM_000545.5
HNF1A Chr12:121416281 c.-291T>C NM_000545.5 rs534474388
HNF1A Chr12:121416285 c.-287G>A NM_000545.5
HNF1A Chr12:121416285 NM_000545.5
HNF1A Chr12:121416289 c.-283A>C NM_000545.5
HNF1A Chr12:121416314 c.-258A>G NM_000545.5 rs756136537
HNF1A Chr12:121416354 c.-218T>C NM_000545.5
HNF1A Chr12:121416385 c.-187C>A/T NM_000545.5
HNF1A Chr12:121416385 NM_000545.5
HNF1A Chr12:121416385 NM_000545.5 rs970766228
HNF1A Chr12:121416391 NM_000545.5
HNF1A Chr12:121416437 NM_000545.5
HNF1A Chr12:121416446 NM_000545.5 rs780586155
HNF1A Chr12:121416453 c.-119G>A NM_000545.5 rs371945966
HNF1A Chr12:121416475 c.-97T>G NM_000545.5
HNF1A Chr12:121416508 NM_000545.5
KCNH2 Chr7:150646165 c.2399-28A>G NM_000238.3
KCNQ1 Chr11:2484803 rs2074238
LDLR Chr19:11199939 NM_000527.4
LDLR Chr19:11199958 c.-267A>G NM_000527.4
LDLR Chr19:11199997 c.-228G>C NM_000527.4 rs376713337
LDLR Chr19:11200000 NM_000527.4
LDLR Chr19:11200019 c.-206C>T NM_000527.4 rs549995837
LDLR Chr19:11200031 NM_000527.4 rs1270618112
LDLR Chr19:11200032 NM_000527.4 rs879254362
LDLR Chr19:11200032 NM_000527.4
LDLR Chr19:11200034 c.-191C>A NM_000527.4
LDLR Chr19:11200037 c.-188C>T NM_000527.4
LDLR Chr19:11200038 c.-185_-183delCTT NM_000527.4
LDLR Chr19:11200053 c.-172G>A NM_000527.4
LDLR Chr19:11200057 c.-168A>G NM_000527.4
LDLR Chr19:11200062 c.-163T>C NM_000527.4
LDLR Chr19:11200064 c.-161A>C NM_000527.4
LDLR Chr19:11200069 c.-156C>T NM_000527.4
LDLR Chr19:11200069 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4
LDLR Chr19:11200069 c.-155_-150delACCCCA NM_000527.4
LDLR Chr19:11200070 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4 rs879254365
LDLR Chr19:11200070 c.-155_-150delACCCCAinsTT NM_000527.4
LDLR Chr19:11200071 c.-154C>T NM_000527.4
LDLR Chr19:11200072 c.-153C>T NM_000527.4
LDLR Chr19:11200073 c.-152C>T NM_000527.4
LDLR Chr19:11200074 c.-151C>G NM_000527.4
LDLR Chr19:11200075 c.-150A>G NM_000527.4
LDLR Chr19:11200076 c.-149C>A NM_000527.4
LDLR Chr19:11200079 c.-146C>A NM_000527.4
LDLR Chr19:11200083 c.-142C>G/T NM_000527.4
LDLR Chr19:11200084 c.-139_-130delCTCCCCCTGC NM_000527.4
LDLR Chr19:11200085 c.-140C>A/G/T NM_000527.4 rs875989887
LDLR Chr19:11200086 c.-139C>A/G NM_000527.4
LDLR Chr19:11200086 c.-138delT NM_000527.4 rs387906307
LDLR Chr19:11200087 c.-138T>C NM_000527.4
LDLR Chr19:11200088 c.-137C>T NM_000527.4
LDLR Chr19:11200089 c.-136C>G/T NM_000527.4
LDLR Chr19:11200089 c.-136C>G NM_000527.4 rs879254374
LDLR Chr19:11200089 c.-136C>T NM_000527.4
LDLR Chr19:11200090 c.-135C>G NM_000527.4
LDLR Chr19:11200091 c.-134C>T NM_000527.4
LDLR Chr19:11200098 c.-124dupA NM_000527.4
LDLR Chr19:11200105 c.-120C>T NM_000527.4 rs875989886
LDLR Chr19:11200124 c.-101T>C NM_000527.4 rs747068848
LDLR Chr19:11200126 c.-99A>G NM_000527.4
LDLR Chr19:11200127 c.-98C>T NM_000527.4
LDLR Chr19:11200202 c.-23A>C NM_000527.4 rs763282380
LDLR Chr19:11200202 c.-22delC NM_000527.4 rs879254379
LDLR Chr19:11200211 c.-14C>A NM_000527.4
LDLR Chr19:11218203 c.940+14delC NM_000527.4 rs879254730
LDLR Chr19:11221315 c.941-13T>A NM_000527.4
LDLR Chr19:11224179 c.1359-31_1359-23delGCGCTGATGinsCGGCT NM_000527.4
LDLR Chr19:11224186 c.1359-25A>G NM_000527.4
LDLR Chr19:11227685 c.1845+11C>G NM_000527.4
LDLR Chr19:11227689 c.1845+15C>A NM_000527.4
LDLR Chr19:11231284 c.2140+86C>G NM_000527.4
LDLR Chr19:11231301 c.2140+103G>T NM_000527.4
LDLR Chr19:11242035 c.*43G>A NM_000527.4 rs879254527
LDLRAP1 Chr1:25870164 c.-17_-12dupGGCGGC NM_015627.2
LDLRAP1 Chr1:25891056 c.748-608G>A NM_015627.2
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
MYBPC3 Chr11:47353394 c.*26+2T>C NM_000256.3
MYBPC3 Chr11:47353821 c.3628-12C>G NM_000256.3 rs371428751
MYBPC3 Chr11:47359371 c.2309-26A>G NM_000256.3
MYBPC3 Chr11:47360310 c.2149-80G>A NM_000256.3
MYBPC3 Chr11:47364709 c.1227-13G>A NM_000256.3 rs397515893
MYBPC3 Chr11:47364832 c.1224-19G>A NM_000256.3 rs587776699
MYBPC3 Chr11:47364865 c.1224-52G>A NM_000256.3 rs786204336
MYBPC3 Chr11:47365750 c.1091-575A>C NM_000256.3
MYBPC3 Chr11:47367305 c.1090+453C>T NM_000256.3
MYBPC3 Chr11:47368602 c.906-22G>A NM_000256.3 rs756267771
MYBPC3 Chr11:47368616 c.906-36G>A NM_000256.3 rs864622197
NEXN Chr1:78381662 c.-52-78C>A NM_144573.3
NKX2-5 Chr5:172662741 NM_004387.3
PCSK9 Chr1:55505180 c.-331C>A NM_174936.3 rs778796405
PLN Chr6:118869382 c.-271A>G NM_002667.4
PLN Chr6:118869417 c.-236C>G NM_002667.4 rs188578681
PROC Chr2:128175983 c.-107A>G NM_000312.3
PROC Chr2:128175984 c.-106A>G NM_000312.3
PROC Chr2:128175988 c.-102T>A NM_000312.3
PROC Chr2:128175991 NM_000312.3
PROC Chr2:128175994 c.-96T>G NM_000312.3
PROC Chr2:128176001 c.-89T>C NM_000312.3
PROC Chr2:128176005 c.-85C>T NM_000312.3
PROC Chr2:128176047 c.-43A>C NM_000312.3
PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007
PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589
PROC Chr2:128180582 c.263-28T>G NM_000312.3
PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3
PROC Chr2:128183562 c.536-99C>G NM_000312.3
PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473
PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3
PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347
PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3 rs199469501
PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3
PROS1 Chr3:93611983 c.966-17C>G NM_000313.3 rs199469490
PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484
PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936
RYR2 Chr1:237730106 c.3423+32dupG NM_001035.2
SCN5A Chr3:38639469 c.2024-11T>A NM_198056.2 rs777987317
SCN5A Chr3:38691021 c.-53+1G>A NM_198056.2
SERPINA1 Chr14:94854894 c.-5+2dupT NM_000295.4
SERPINA1 Chr14:94854896 c.-5+1G>A NM_000295.4 rs775786225
SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3
SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3
SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3
TBX20 Chr7:35293780 c.-549G>A NM_001077653.2 rs571512677
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
TPM1 Chr15:63349172 c.241-12_241-11delCTinsTG NM_001018005.1 rs199476309
TRDN Chr6:123957870 c.22+29A>G NM_006073.3 rs774068079

Conditions screened Genes
Cardiovascular Disease
Aortopathy and connective tissue disorders ACTA2, COL3A1, COL5A1, COL5A2, FBN1, MYH11, MYLK*, PRKG1, SMAD3, TGFB2, TGFB3, TGFBR1, TGFBR2
Cardiomyopathy ACTC1, ACTN2, BAG3, CASZ1, CHRM2, CSRP3, DES, DMD, DSC2, DSG2, DSP, EMD, FHL1*, FLNC*, GAA, GATA4, GLA, JUP, LAMP2, LMNA, LMOD2, MYBPC3, MYH7, MYL2, MYL3, NEXN, NKX2-5, PKP2#*, PLN, PRKAG2, RAF1, RBM20, SGCD, TAB2, TBX20*, TCAP, TMEM43, TNNC1, TNNI3, TNNT2, TPM1, TTN*, TTR, VCL
Channelopathy/Inherited Arrhythmia CACNA1C*, CALM1*, CALM2, CALM3, CASQ2, HCN4, KCNE1, KCNE2, KCNH2, KCNJ2, KCNQ1, RYR2, SCN5A, TECRL, TRDN
Hereditary Hemorrhagic Telangiectasia ACVRL1, ENG, GDF2
Hypercholesterolemia APOB, LDLR, LDLRAP1, PCSK9
Pulmonary Arterial Hypertension BMPR2,CAV1, SMAD4, SMAD9
Pulmonary Fibrosis TERT, TERC, TINF2
Other medical disorders
Alpha-1-Antitrypsin SERPINA1
Hereditary Hemochromatosis HFE
Liddle syndrome SCNN1B, SCNN1G
Thrombophilia F5, PROC, PROS1*, SERPINC1
Maturity onset diabetes of the young (MODY) HNF1A

Some genes in the tables above may be associated with more than one genetic condition or hereditary predisposition that may or may not have a different inheritance pattern (eg. variants in the SMAD4 gene are associated with gastrointestinal cancer predisposition and hereditary hemorrhagic telangiectasia). As a result, disease-causing variants (meeting a likely pathogenic or pathogenic classification) that are associated with conditions other than those specifically listed may still be included in a patient’s report.

In addition, carrier status (defined as a single disease-causing variant in a gene associated with autosomal recessive inheritance) will be reported as an incidental finding (under the “Carriership of autosomal recessive disease” heading) on the patient’s report

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

* Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Non-coding variants covered by Comprehensive Cardiology Screen

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ACTC1 Chr15:35080829 c.*1784T>C NM_005159.4
ACVRL1 Chr12:52314269 c.1378-274C>G NM_000020.2
ACVRL1 Chr12:52314327 c.1378-216C>G NM_000020.2
ACVRL1 Chr12:52314387 c.1378-156_1378-155invCT NM_000020.2
ACVRL1 Chr12:52314412 c.1378-131C>G NM_000020.2
ACVRL1 Chr12:52314465 c.1378-78T>G NM_000020.2
ACVRL1 Chr12:52314474 c.1378-69C>A NM_000020.2
BMPR2 Chr2:203241251 c.-947_-946delGCinsAT NM_001204.6 rs1085307144
BMPR2 Chr2:203241851 c.-347C>T NM_001204.6
BMPR2 Chr2:203241919 c.-279C>A NM_001204.6
BMPR2 Chr2:203242106 c.-92C>A NM_001204.6
BMPR2 Chr2:203395505 c.968-12T>G NM_001204.6
CAV1 Chr7:116165023 c.-88delC NM_001753.4
COL3A1 Chr2:189872183 c.3256-43T>G NM_000090.3 rs587779667
COL5A1 Chr9:137645685 c.1720-11T>A NM_000093.4 rs863223444
COL5A1 Chr9:137680989 c.2647-12A>G NM_000093.4
COL5A1 Chr9:137686903 c.2701-25T>G NM_000093.4 rs765079080
COL5A1 Chr9:137726806 c.5137-11T>A NM_000093.4 rs183495554
COL5A2 Chr2:189927655 c.1924-11T>C NM_000393.3
DMD ChrX:31165653 c.10554-18C>G NM_004006.2
DMD ChrX:31200680 c.9974+175T>A NM_004006.2
DMD ChrX:31224814 c.9564-30A>T NM_004006.2
DMD ChrX:31225211 c.9564-427T>G NM_004006.2
DMD ChrX:31226400 c.9563+1215A>G NM_004006.2
DMD ChrX:31229031 c.9362-1215A>G NM_004006.2
DMD ChrX:31241047 c.9361+117A>G NM_004006.2
DMD ChrX:31279293 c.9225-160A>G NM_004006.2
DMD ChrX:31279418 c.9225-285A>G NM_004006.2
DMD ChrX:31279420 c.9225-287C>A NM_004006.2
DMD ChrX:31279780 c.9225-647A>G NM_004006.2 rs398124091
DMD ChrX:31279781 c.9225-648A>G NM_004006.2 rs398124084
DMD ChrX:31332523 c.9224+9192C>A NM_004006.2
DMD ChrX:31382270 c.9085-15519G>T NM_004006.2
DMD ChrX:31613687 c.8217+32103G>T NM_004006.2
DMD ChrX:31627738 c.8217+18052A>G NM_004006.2
DMD ChrX:31697714 c.7661-11T>C NM_004006.2
DMD ChrX:31983146 c.6614+3310G>T NM_004006.2 rs797045526
DMD ChrX:32305833 c.6118-15A>G NM_004006.2
DMD ChrX:32360414 c.5740-15G>T NM_004006.2
DMD ChrX:32366860 c.5326-215T>G NM_004006.2
DMD ChrX:32379144 c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA NM_004006.2
DMD ChrX:32398808 c.4675-11A>G NM_004006.2
DMD ChrX:32460274 c.3787-843C>A NM_004006.2
DMD ChrX:32470726 c.3603+2053G>C NM_004006.2
DMD ChrX:32479316 c.3432+2240A>G NM_004006.2
DMD ChrX:32479520 c.3432+2036A>G NM_004006.2
DMD ChrX:32669100 c.961-5831C>T NM_004006.2 rs398124099
DMD ChrX:32669194 c.961-5925A>C NM_004006.2
DMD ChrX:32716130 c.832-15A>G NM_004006.2 rs72470513
DMD ChrX:32827744 c.531-16T>A/G NM_004006.2
DMD ChrX:32827744 c.531-16T>A NM_004006.2
DMD ChrX:32827744 c.531-16T>G NM_004006.2
DMD ChrX:32841967 c.265-463A>G NM_004006.2
DMD ChrX:33032666 c.93+5590T>A NM_004006.2
DMD ChrX:33192452 c.31+36947G>A NM_004006.2
DMD ChrX:33229483 c.-54T>A NM_004006.2
DSC2 Chr18:28683379 c.-1445G>C NM_024422.4 rs75494355
EMD ChrX:153608559 c.266-27_266-10delTCTGCTACCGCTGCCCCC NM_000117.2
ENG Chr9:130578354 c.1742-22T>C NM_001114753.2
ENG Chr9:130588962 c.361-11T>A NM_001114753.2
ENG Chr9:130616692 c.-58G>A NM_001114753.2 rs971268057
ENG Chr9:130616761 c.-127C>T NM_001114753.2
ENG Chr9:130616776 c.-142A>T NM_001114753.2
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
GAA Chr17:78078341 c.-32-13T>G NM_000152.3 rs386834236
GAA Chr17:78078341 c.-32-13T>A NM_000152.3
GAA Chr17:78078351 c.-32-3C>A/G NM_000152.3
GAA Chr17:78078352 c.-32-2A>G NM_000152.3
GAA Chr17:78078353 c.-32-1G>C NM_000152.3
GAA Chr17:78078369 c.-17C>T NM_000152.3
GAA Chr17:78082266 c.1076-22T>G NM_000152.3 rs762260678
GAA Chr17:78090422 c.2190-345A>G NM_000152.3
GAA Chr17:78092432 c.2647-20T>G NM_000152.3
GATA4 Chr8:11561282 c.-989C>T NM_002052.3
GATA4 Chr8:11561369 c.-902G>T NM_002052.3
GATA4 Chr8:11561399 NM_002052.3 rs1195641788
GATA4 Chr8:11612500 c.910-55T>C NM_002052.3
GATA4 Chr8:11612745 c.997+103G>T NM_002052.3 rs113049875
GATA4 Chr8:11614418 c.998-26G>A NM_002052.3
GLA ChrX:100653945 c.640-11T>A NM_000169.2
GLA ChrX:100654735 c.640-801G>A NM_000169.2 rs199473684
GLA ChrX:100654793 c.640-859C>T NM_000169.2 rs869312374
GLA ChrX:100656225 c.547+395G>C NM_000169.2
HFE Chr6:26087649 c.-20G>A NM_000410.3 rs138378000
HNF1A Chr12:121416034 c.-538G>C NM_000545.5
HNF1A Chr12:121416110 c.-462G>A NM_000545.5
HNF1A Chr12:121416281 c.-291T>C NM_000545.5 rs534474388
HNF1A Chr12:121416285 c.-287G>A NM_000545.5
HNF1A Chr12:121416285 NM_000545.5
HNF1A Chr12:121416289 c.-283A>C NM_000545.5
HNF1A Chr12:121416314 c.-258A>G NM_000545.5 rs756136537
HNF1A Chr12:121416354 c.-218T>C NM_000545.5
HNF1A Chr12:121416385 c.-187C>A/T NM_000545.5
HNF1A Chr12:121416385 NM_000545.5
HNF1A Chr12:121416385 NM_000545.5 rs970766228
HNF1A Chr12:121416391 NM_000545.5
HNF1A Chr12:121416437 NM_000545.5
HNF1A Chr12:121416446 NM_000545.5 rs780586155
HNF1A Chr12:121416453 c.-119G>A NM_000545.5 rs371945966
HNF1A Chr12:121416475 c.-97T>G NM_000545.5
HNF1A Chr12:121416508 NM_000545.5
KCNH2 Chr7:150646165 c.2399-28A>G NM_000238.3
KCNQ1 Chr11:2484803 rs2074238
LDLR Chr19:11199939 NM_000527.4
LDLR Chr19:11199958 c.-267A>G NM_000527.4
LDLR Chr19:11199997 c.-228G>C NM_000527.4 rs376713337
LDLR Chr19:11200000 NM_000527.4
LDLR Chr19:11200019 c.-206C>T NM_000527.4 rs549995837
LDLR Chr19:11200031 NM_000527.4 rs1270618112
LDLR Chr19:11200032 NM_000527.4 rs879254362
LDLR Chr19:11200032 NM_000527.4
LDLR Chr19:11200034 c.-191C>A NM_000527.4
LDLR Chr19:11200037 c.-188C>T NM_000527.4
LDLR Chr19:11200038 c.-185_-183delCTT NM_000527.4
LDLR Chr19:11200053 c.-172G>A NM_000527.4
LDLR Chr19:11200057 c.-168A>G NM_000527.4
LDLR Chr19:11200062 c.-163T>C NM_000527.4
LDLR Chr19:11200064 c.-161A>C NM_000527.4
LDLR Chr19:11200069 c.-156C>T NM_000527.4
LDLR Chr19:11200069 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4
LDLR Chr19:11200069 c.-155_-150delACCCCA NM_000527.4
LDLR Chr19:11200070 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4 rs879254365
LDLR Chr19:11200070 c.-155_-150delACCCCAinsTT NM_000527.4
LDLR Chr19:11200071 c.-154C>T NM_000527.4
LDLR Chr19:11200072 c.-153C>T NM_000527.4
LDLR Chr19:11200073 c.-152C>T NM_000527.4
LDLR Chr19:11200074 c.-151C>G NM_000527.4
LDLR Chr19:11200075 c.-150A>G NM_000527.4
LDLR Chr19:11200076 c.-149C>A NM_000527.4
LDLR Chr19:11200079 c.-146C>A NM_000527.4
LDLR Chr19:11200083 c.-142C>G/T NM_000527.4
LDLR Chr19:11200084 c.-139_-130delCTCCCCCTGC NM_000527.4
LDLR Chr19:11200085 c.-140C>A/G/T NM_000527.4 rs875989887
LDLR Chr19:11200086 c.-139C>A/G NM_000527.4
LDLR Chr19:11200086 c.-138delT NM_000527.4 rs387906307
LDLR Chr19:11200087 c.-138T>C NM_000527.4
LDLR Chr19:11200088 c.-137C>T NM_000527.4
LDLR Chr19:11200089 c.-136C>G/T NM_000527.4
LDLR Chr19:11200089 c.-136C>G NM_000527.4 rs879254374
LDLR Chr19:11200089 c.-136C>T NM_000527.4
LDLR Chr19:11200090 c.-135C>G NM_000527.4
LDLR Chr19:11200091 c.-134C>T NM_000527.4
LDLR Chr19:11200098 c.-124dupA NM_000527.4
LDLR Chr19:11200105 c.-120C>T NM_000527.4 rs875989886
LDLR Chr19:11200124 c.-101T>C NM_000527.4 rs747068848
LDLR Chr19:11200126 c.-99A>G NM_000527.4
LDLR Chr19:11200127 c.-98C>T NM_000527.4
LDLR Chr19:11200202 c.-23A>C NM_000527.4 rs763282380
LDLR Chr19:11200202 c.-22delC NM_000527.4 rs879254379
LDLR Chr19:11200211 c.-14C>A NM_000527.4
LDLR Chr19:11218203 c.940+14delC NM_000527.4 rs879254730
LDLR Chr19:11221315 c.941-13T>A NM_000527.4
LDLR Chr19:11224179 c.1359-31_1359-23delGCGCTGATGinsCGGCT NM_000527.4
LDLR Chr19:11224186 c.1359-25A>G NM_000527.4
LDLR Chr19:11227685 c.1845+11C>G NM_000527.4
LDLR Chr19:11227689 c.1845+15C>A NM_000527.4
LDLR Chr19:11231284 c.2140+86C>G NM_000527.4
LDLR Chr19:11231301 c.2140+103G>T NM_000527.4
LDLR Chr19:11242035 c.*43G>A NM_000527.4 rs879254527
LDLRAP1 Chr1:25870164 c.-17_-12dupGGCGGC NM_015627.2
LDLRAP1 Chr1:25891056 c.748-608G>A NM_015627.2
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
MYBPC3 Chr11:47353394 c.*26+2T>C NM_000256.3
MYBPC3 Chr11:47353821 c.3628-12C>G NM_000256.3 rs371428751
MYBPC3 Chr11:47359371 c.2309-26A>G NM_000256.3
MYBPC3 Chr11:47360310 c.2149-80G>A NM_000256.3
MYBPC3 Chr11:47364709 c.1227-13G>A NM_000256.3 rs397515893
MYBPC3 Chr11:47364832 c.1224-19G>A NM_000256.3 rs587776699
MYBPC3 Chr11:47364865 c.1224-52G>A NM_000256.3 rs786204336
MYBPC3 Chr11:47365750 c.1091-575A>C NM_000256.3
MYBPC3 Chr11:47367305 c.1090+453C>T NM_000256.3
MYBPC3 Chr11:47368602 c.906-22G>A NM_000256.3 rs756267771
MYBPC3 Chr11:47368616 c.906-36G>A NM_000256.3 rs864622197
NEXN Chr1:78381662 c.-52-78C>A NM_144573.3
NKX2-5 Chr5:172662741 NM_004387.3
PCSK9 Chr1:55505180 c.-331C>A NM_174936.3 rs778796405
PLN Chr6:118869382 c.-271A>G NM_002667.4
PLN Chr6:118869417 c.-236C>G NM_002667.4 rs188578681
PROC Chr2:128175983 c.-107A>G NM_000312.3
PROC Chr2:128175984 c.-106A>G NM_000312.3
PROC Chr2:128175988 c.-102T>A NM_000312.3
PROC Chr2:128175991 NM_000312.3
PROC Chr2:128175994 c.-96T>G NM_000312.3
PROC Chr2:128176001 c.-89T>C NM_000312.3
PROC Chr2:128176005 c.-85C>T NM_000312.3
PROC Chr2:128176047 c.-43A>C NM_000312.3
PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007
PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589
PROC Chr2:128180582 c.263-28T>G NM_000312.3
PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3
PROC Chr2:128183562 c.536-99C>G NM_000312.3
PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473
PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3
PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347
PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3 rs199469501
PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3
PROS1 Chr3:93611983 c.966-17C>G NM_000313.3 rs199469490
PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484
PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936
RYR2 Chr1:237730106 c.3423+32dupG NM_001035.2
SCN5A Chr3:38639469 c.2024-11T>A NM_198056.2 rs777987317
SCN5A Chr3:38691021 c.-53+1G>A NM_198056.2
SERPINA1 Chr14:94854894 c.-5+2dupT NM_000295.4
SERPINA1 Chr14:94854896 c.-5+1G>A NM_000295.4 rs775786225
SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3
SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3
SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3
TBX20 Chr7:35293780 c.-549G>A NM_001077653.2 rs571512677
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
TPM1 Chr15:63349172 c.241-12_241-11delCTinsTG NM_001018005.1 rs199476309
TRDN Chr6:123957870 c.22+29A>G NM_006073.3 rs774068079

Test Strengths

The strengths of this test include:

  • CAP-accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods, and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal provides transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrates complete details of test performance
  • ~2,000 non-coding disease-causing variants in our clinical-grade NGS assay for panels (please see ‘Non-coding disease-causing variants covered by this test’)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enables accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

Special reporting policies:

HFE: only homozygous c.845G>A, p.(Cys282Tyr) (NM_000410.4) is reported

TTN: missense and in-frame indel variants are not reported

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: PKP2 NM_004572.4:6. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low-level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low-level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease-causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing a molecular diagnosis.

The coding regions of HBA1 and HBA2 are identical and the mapping of short reads from next-generation sequencing (NGS) data relies purely on differences in the intronic regions and/or the UTR. This reduces sensitivity for detecting variants in these regions when using standard NGS methods. However, the Blueprint Genetics custom assay has good coverage (>20x) with improved mapping rates (mapping quality >40) within the target regions of these genes. In addition, our validation showed deep mean depth of coverage. We have been able to detect sequence variants and some of the known disease-associated deletions using our assay; however, there may be reduced sensitivity to detect variants in these genes (including gene fusions and some deletions).

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the test performance section.

Special reporting policies:

HFE: only homozygous c.845G>A, p.(Cys282Tyr) (NM_000410.4) is reported

TTN: missense and in-frame indel variants are not reported

The genes on the panels have been carefully selected based on scientific literature, mutation databases, and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis includes a combination of both sequence variants (single nucleotide variants (SNV’s) and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter paper cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes ProjectgnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFTPolyPhenMutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with the most comprehensive report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists prepare the report by assessing the pathogenicity of the identified variants. Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics.  

Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.  

Our screening panel report includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the report includes descriptions of the variant and its association with disease. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.  

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis, or in proactive testing, to confer a risk of developing an inherited disease. In reproductive screening, identification of single pathogenic or likely pathogenic variants in genes related to recessive disorders is considered as a carriership. Disease risk of potential offspring depends on whether both parents have a pathogenic or likely pathogenic variant in the same gene. Reproductive risk related to X-linked disorders may be difficult to estimate due to the possibility of skewed X-chromosome inactivation. Genetic counseling is recommended whenever pathogenic or likely pathogenic variants are reported. 

Reporting focuses on high-quality variants that meet our stringent NGS quality metrics for a true positive call but they are not confirmed with alternative methods. Ordering healthcare professionals should consider further confirmation of the reported variants using a diagnostic test.

Other