Comprehensive Immune and Cytopenia Panel

Summary
Is a 642 gene panel that includes assessment of non-coding variants.

It is ideal for patients with hematologic and/or immunologic presentations.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
642
Test code
IM0902
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Comprehensive Immune and Cytopenia Panel (test code IM0902):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Immunological and hematological disorders may present with variable overlapping manifestations. As clinical findings may be unspecific, having to select 1 or more smaller gene panels based on a patient’s symptoms can delay the identification of the disease-causing genetic alterations and optimal disease management. To enable a fast and accurate diagnosis, this panel covers a broad range of immuno-hematologic disorders including: primary immunodeficiency, bone marrow failure, complement disorders, autoinflammatory disorders, neutropenia, and thrombocytopenia.

Genes in the Comprehensive Immune and Cytopenia Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ABCB7 Anemia, sideroblastic, and spinocerebellar ataxia XL 8 9
ABCG5 Sitosterolemia AR 13 42
ABCG8 Sitosterolemia AR 18 44
ACD Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7 AD/AR 2 8
ACP5 Spondyloenchondrodysplasia with immune dysregulation AR 12 26
ACTB* Baraitser-Winter syndrome AD 55 60
ACTG1* Deafness, Baraitser-Winter syndrome AD 27 47
ACTN1 Bleeding disorder, platelet-type 15 AD 7 25
ADA Severe combined immunodeficiency due to adenosine deaminase deficiency AR 49 93
ADAM17 Inflammatory skin and bowel disease, neonatal 1 AR 1 7
ADAMTS13 Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, familial AR 30 183
ADAMTS3 Hennekam lymphangiectasia-lymphedema syndrome AR 1 3
ADAR Dyschromatosis symmetrica hereditaria, Aicardi-Goutières syndrome AD/AR 25 226
ADIPOQ Complement system AD/AR 2 8
ADIPOR1* Complement system AD/AR 4
ADIPOR2 Complement system AD/AR 1 1
AICDA Immunodeficiency with hyper-IgM AD/AR 14 50
AIRE Autoimmune polyendocrinopathy syndrome AD/AR 73 134
AK2 Reticular dysgenesis AR 14 17
ALAS2 Anemia, sideroblastic, Protoporphyria, erythropoietic XL 27 103
ALPI Inflammatory bowel disease AR 5
ANKRD11* KBG syndrome AD 142 132
ANKRD26 Thrombocytopenia AD 6 21
AP1S3 Psoriasis 15, pustular, susceptibility to AD 6
AP3B1 Hermansky-Pudlak syndrome AR 14 34
AP3D1 Hermansky-Pudlak syndrome 10 AR 1 4
APOL1* Sporadic idiopathic steroid-resistant nephrotic syndrome with focal segmental hyalinosis AD/AR 1
ARHGEF1 Idiopathic bronchiectasis, Immunodeficiencies with antibody defects AR 1
ARMC4#* Ciliary dyskinesia AR 18 17
ARPC1B Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease AR 2 4
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
ATP6AP1 Immunodeficiency 47 XL 5 5
ATR Cutaneous telangiectasia and cancer syndrome, Seckel syndrome AD/AR 10 33
ATRX Carpenter-Waziri syndrome, Alpha-thalassemia/mental retardation syndrome, Holmes-Gang syndrome, Juberg-Marsidi syndrome, Smith-Fineman-Myers syndrome, Mental retardation-hypotonic facies syndrome XL 65 165
B2M Amyloidosis, systemic visceral AR 8 4
BACH2 BACH2-related immunodeficiency and autoimmunity (BRIDA) AD 2
BCL10 Immunodeficiency 37 AR 16 1
BCL11B Immunodeficiency 49 AD 8 12
BCO1 Hypercarotenemia and vitamin A deficiency, autosomal dominant AD/AR 1 2
BLM Bloom syndrome AR 152 119
BLNK Agammaglobulinemia 4 AR 2 3
BLOC1S3 Hermansky-Pudlak syndrome AR 2 4
BLOC1S6 Hermansky-Pudlak syndrome AR 1 2
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 134 65
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial, Fanconi anemia AD/AR 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 3369 2659
BRIP1 Fanconi anemia, Ovarian cancer, familial AD/AR 238 189
BTK Hypogammaglobulinemia, Agammaglobulinemia and isolated hormone deficiency, Agammaglobulinemia XL 114 908
C11ORF70 Primary ciliary dyskinesia AR 5
C15ORF41 Congenital dyserythropoietic anemia AR 3 3
C17ORF62 Chronic granulomatous disease AR 1
C1QA C1q deficiency AR 2 7
C1QB C1q deficiency AR 4 8
C1QBP Primary immunodeficiency AD/AR 6 7
C1QC C1q deficiency AR 4 10
C1R Ehlers-Danlos syndrome, periodontal type 1 AD/AR 15 17
C1S Complement component C1s deficiency AD/AR 4 10
C2* Complement component 2 deficiency AR 4 9
C21ORF59 Ciliary dyskinesia AR 5 4
C3 Hemolytic uremic syndrome, atypical, Complement component 3 deficiency, Macular degeneration, age-related AD/AR 6 87
C3AR1 Complement system AD/AR 1 4
C4BPA Complement system AD/AR 4
C4BPB Complement system AD/AR 1
C5# Eculizumab, poor response to, Complement component 5 deficiency AD/AR 6 18
C5AR1 Complement system AD/AR
C5AR2 Complement system AD/AR 2
C6 Complement component 6 deficiency AR 8 12
C7 Complement component 7 deficiency AR 14 31
C8A Complement component 8 deficiency AR 2 8
C8B Complement component 8 deficiency AR 7 8
C8G Immunodeficiency AD/AR
C9 Complement component 9 deficiency AR 7 9
CARD11 B-cell expansion with NFKB and T-cell anergy, Immunodeficiency AD/AR 12 9
CARD14 Psoriasis AD 9 29
CARD9 Candidiasis, familial, 2 AR 8 25
CASP10 Autoimmune lymphoproliferative syndrome AD 5 7
CASP8 Caspase 8 defiency AR 2 7
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 24 43
CCBE1 Hennekam lymphangiectasia-lymphedema syndrome AR 6 13
CCDC103 Ciliary dyskinesia AR 4 5
CCDC114 Ciliary dyskinesia, primary, 20 AR 9 8
CCDC39 Ciliary dyskinesia AR 39 47
CCDC40 Ciliary dyskinesia AR 33 43
CCDC65 Ciliary dyskinesia AR 2 2
CCNK AD
CCNO Ciliary dyskinesia AR 11 10
CD19 Immunodeficiency, common variable AR 8 9
CD247 Immunodeficiency AR 8 4
CD27 Lymphoproliferative syndrome AR 4 8
CD3D Immunodeficiency AR 3 5
CD3E Immunodeficiency AR 4 7
CD3G Immunodeficiency AR 5 3
CD40 Immunodeficiency with Hyper-IgM AR 5 10
CD40LG Immunodeficiency, with hyper-IgM XL 35 231
CD46* Hemolytic uremic syndrome, atypical AD/AR 5 81
CD55# Blood group, Cromer system BG 7 7
CD59 CD59 deficiency AR 4 8
CD70 Primary immunodeficiency AR 4
CD79A Agammaglobulinemia 3 AR 3 7
CD79B Agammaglobulinemia 6 AR 2 3
CD81 Immunodeficiency, common variable, 6 AR 1 1
CD8A CD8 deficiency AR 1 1
CD93 Complement system AD/AR
CDAN1 Anemia, dyserythropoietic congenital AR 12 61
CDC42* Takenouchi-Kosaki syndrome, Noonan-syndrome like phenotype AD 11 9
CDCA7 Immunodeficiency-centromeric instability-facial anomalies syndrome 3 AR 4 6
CDK9 AR 1
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 87 232
CEBPA Acute myeloid leukemia, familial AD 15 13
CEBPE Specific granule deficiency 1 AR 3 4
CECR1 Polyarteritis nodosa, ADA2 deficiency AR 15 50
CENPF Ciliary dyskinesia -Lethal Ciliopathy AR 13 8
CFB Complement factor B deficiency, Hemolytic uremic syndrome, atypical AD/AR 2 26
CFD Complement factor D deficiency AR 2 3
CFH* Hemolytic uremic syndrome, atypical, Complement factor H deficiency, Basal laminar drusen AD/AR 18 305
CFHR5 Atypical hemolytic-uremic syndrome with anti-factor H antibodies, C3 glomerulonephritis AD/AR 4 32
CFI Hemolytic uremic syndrome, atypical, Complement factor I deficiency AD/AR 10 143
CFP Properdin deficiency XL 5 17
CFTR Cystic fibrosis, Congenital bilateral absence of the vas deferens AD/AR 518 1803
CHD7 Isolated gonadotropin-releasing hormone deficiency, CHARGE syndrome AD 276 860
CHEK2#* Breast cancer, susceptibility to AD/AR 275 197
CIB1
CIITA Bare lymphocyte syndrome AR 9 15
CLCN7 Osteopetrosis AD/AR 15 98
CLEC7A Candidiasis, familial, 4 AR
CLPB 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) AD/AR 26 25
CLU Complement system AD/AR 17
COG6 Congenital disorder of glycosylation, Shaheen syndrome AR 10 9
COLEC11 3MC syndrome AR 6 13
COPA Autoimmune interstitial lung, joint, and kidney disease AD 6 6
CORO1A#* Immunodeficiency AR 41 6
CPT2 Carnitine palmitoyltransferase II deficiency AR 72 111
CR2 Common variable immunodeficiency AR 2 16
CREBBP Rubinstein-Taybi syndrome AD 175 362
CRP Complement system AD/AR
CSF2RA#* Surfactant metabolism dysfunction, pulmonary XL 2 17
CSF2RB Surfactant metabolism dysfunction, pulmonary, 5 AR 2 6
CSF3R Neutrophilia, hereditary AD/AR 13 13
CTC1 Cerebroretinal microangiopathy with calcifications and cysts AR 21 33
CTLA4 Autoimmune lymphoproliferative syndrome, type V AD 11 34
CTNNBL1
CTPS1 Immunodeficiency 24 AR 1 1
CTSC Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome AR 19 92
CXCR2 Congenital neutropenia AR 1
CXCR4 Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome AD 5 15
CYBA Chronic granulomatous disease AR 13 71
CYBB Chronic granulomatous disease, Immunodeficiency XL 69 780
CYCS* Thrombocytopenia AD 2 3
CYP27A1 Cerebrotendinous xanthomatosis AR 69 110
DBR1 Immunodeficiency AR 1
DCLRE1B 1
DCLRE1C* Omenn syndrome, Severe combined immunodeficiency with sensitivity to ionizing radiation AR 18 89
DDX11* Warsaw breakage syndrome AR 7 7
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to AD 9 21
DDX58 Singleton-Merten syndrome AD 4 3
DEF6
DGAT1 Diarrhea AR 7 11
DGKE Nephrotic syndrome AR 17 38
DHFR* Megaloblastic anemia due to dihydrofolate reductase deficiency AR 2 5
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 48 74
DNAAF1 Ciliary dyskinesia AR 19 38
DNAAF2 Ciliary dyskinesia AR 13 6
DNAAF3 Primary ciliary dyskinesia AR 11 5
DNAAF5 Ciliary dyskinesia AR 9 5
DNAH1 Spermatogenic failure 18, Ciliary dyskinesia, primary, 37 AR 15 32
DNAH11* Ciliary dyskinesia AR 66 130
DNAH5 Ciliary dyskinesia AR 140 197
DNAH9 Primary ciliary dyskinesia AR 6
DNAI1 Ciliary dyskinesia AR 17 35
DNAI2 Ciliary dyskinesia AR 19 6
DNAJC21 Bone marrow failure syndrome 3 AR 5 11
DNAL1 Ciliary dyskinesia AR 3 1
DNASE1L3 Systemic lupus erythematosus 16 AR 1 3
DNASE2 Autoinflammatory-pancytopenia syndrome AR 2
DNMT3B Immunodeficiency-centromeric instability-facial anomalies syndrome AR 14 47
DOCK2 Immunodeficiency AR 7 6
DOCK8 Hyper-IgE recurrent infection syndrome, Mental retardation, autosomal dominant 2 AR 54 168
DRC1 Ciliary dyskinesia, primary, 21 AR 5 3
DTNBP1 Hermansky-Pudlak syndrome AR 2 3
DYX1C1 Ciliary dyskinesia AR 15 12
EFL1* Shwachman-Diamond syndrome AR 3 2
EIF2AK3 SED, Wolcott-Rallison type AR 9 80
ELANE Neutropenia AD 43 217
EP300 Rubinstein-Taybi syndrome AD 63 101
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
EPG5 Vici syndrome AR 36 66
EPO 3 4
ERBB2IP 1 5
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive, Cerebrooculofacioskeletal syndrome 2 AR 26 98
ERCC3 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 10 19
ERCC4 Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome AR 13 70
ERCC6L2 Bone marrow failure syndrome 2 AR 4 9
ETV6 Thrombocytopenia 5 AD 10 38
EXTL3 Immunoskeletal dysplasia with neurodevelopmental abnormalities (ISDNA) AR 4 8
FAAP100
FAAP24 2
FADD Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations AR 2 1
FANCA Fanconi anemia AR 191 677
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FANCD2* Fanconi anemia AR 21 61
FANCE Fanconi anemia AR 4 17
FANCF Fanconia anemia AR 7 16
FANCG Fanconi anemia AR 16 92
FANCI Fanconi anemia AR 13 45
FANCL Fanconi anemia AR 13 24
FANCM Premature ovarian failure AR 6 50
FAS Autoimmune lymphoproliferative syndrome AD/AR 31 133
FASLG Autoimmune lymphoproliferative syndrome, type IB AD/AR 2 10
FAT4 Van Maldergem syndrome 2 AR 13 33
FCGR3A* Immunodeficiency 20 AR 1
FCHO1 Combined immunodeficiency AR
FCN1 Complement system AD/AR 4
FCN2 Complement system AD/AR 1
FCN3 Immunodeficiency due to Ficolin 3 deficiency AR 1
FERMT1 Kindler syndrome AR 32 83
FERMT3 Leukocyte adhesion deficiency AR 8 14
FLG* Icthyosis vulgaris AD/AR 83 109
FLI1 Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet type 21 AD 7 7
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects, Periventricular nodular heterotopia 1, Melnick-Needles syndrome, Intestinal pseudoobstruction, neuronal, X-linked/Congenital short bowel syndrome, Cardiac valvular dysplasia, X-linked XL 133 257
FOXN1 T-cell immunodeficiency, congenital alopecia, and nail dystrophy AD/AR 6 6
FOXP3 Immunodysregulation, polyendocrinopathy, and enteropathy XL 28 93
FPR1 1
FYB Thrombocytopenia 3 AR 2 2
G6PC3 Neutropenia, severe congenital, Dursun syndrome AR 11 37
G6PD Glucose-6-phosphate dehydrogenase deficiency XL 45 226
GAS2L2 Primary ciliary dyskinesia AR 3
GAS8 Ciliary dyskinesia, primary, 33 AR 4 6
GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta-thalessemia,, Dyserythropoietic anemia with thrombocytopenia XL 21 15
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GBA* Gaucher disease AR 84 488
GFI1 Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults AD 2 6
GFI1B Bleeding disorder, platelet-type, 17 AD 6 9
GINS1 Immunodeficiency AR 4 4
GLRX5 Spasticity, childhood-onset, with hyperglycinemia AR 5 6
GNE Proximal myopathy and ophthalmoplegia, Nonaka myopathy, Sialuria AD/AR 78 214
GP1BA Pseudo-von Willebrand disease, Bernard-Soulier syndrome AD/AR 9 73
GP1BB Giant platelet disorder, isolated, Bernard-Soulier syndrome AD/AR 5 53
GP9 Bernard-Soulier syndrome AR 6 42
GTF2H5 Trichothiodystrophy 3, photosensitive AR 2 6
GUCY2C Diarrhea, Meconium ileus AD/AR 7 10
HAVCR2 AR
HAX1 Neutropenia, severe congenital AR 11 21
HELLS Immunodeficiency-centromeric instability-facial anomalies syndrome 4 AR 6 6
HMOX1 Heme oxygenase 1 deficiency AR 2 5
HNRNPK* Au-Kline syndrome AD 14 10
HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia AD 1 1
HPS1* Hermansky-Pudlak syndrome AR 28 55
HPS3* Hermansky-Pudlak syndrome AR 10 17
HPS4 Hermansky-Pudlak syndrome AR 16 22
HPS5 Hermansky-Pudlak syndrome AR 20 31
HPS6 Hermansky-Pudlak syndrome AR 13 37
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 43 31
HSPA9 Even-Plus syndrome AD/AR 5 13
HYDIN#* Primary ciliary dyskinesia AR 5 25
HYOU1 Combined immunodeficiency AR 2
ICOS Immunodeficiency, common variable, 1 AR 3 4
ICOSLG 1
IFIH1 Singleton-Merten syndrome, Aicardi-Goutieres syndrome 7 AD/AR 14 19
IFNAR1 1
IFNAR2 Immunodeficiency 45 AR 1 2
IFNGR1 Immunodeficiency AD/AR 16 42
IFNGR2 Immunodeficiency AR 4 18
IGLL1* Agammaglobulinemia AR 2 3
IKBKB Immunodeficiency 15 AR 2 7
IKZF1 Immunodeficiency, common variable, 13 AD 10 35
IL10 Inflammatory bowel disease AD/AR 1 5
IL10RA Inflammatory bowel disease AR 4 43
IL10RB Inflammatory bowel disease AR 2 19
IL12B Immunodeficiency 28, Immunodeficiency 29 AR 4 13
IL12RB1# Immunodeficiency AR 13 82
IL12RB2 1 5
IL17F Candidiasis, familial, 6 AD 1 2
IL17RA Immunodeficiency 51 AR 8 17
IL17RC Candiasis, familial, 9 AR 3 4
IL18BP
IL1RN Osteomyelitis, sterile multifocal, with periostitis and pustulosis AR 6 12
IL21 Immunodeficiency, common variable, 11 AR 1 1
IL21R Immunodeficiency, primary, autosomal recessive, IL21R-related AD/AR 3 9
IL23R Primary immunodeficiency AR 1
IL2RA Interleukin 2 receptor, alpha, deficiency AR 6 6
IL2RB Autoinflammatory-pancytopenia syndrome AR
IL2RG Combined immunodeficiency XL 54 243
IL36RN Pustular psoriasis, generalized AR 6 26
IL6R# Autoinflammatory-pancytopenia syndrome AR 1
IL6ST* Autoinflammatory-pancytopenia syndrome AD/AR
IL7R Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive AR 23 48
INO80 2 6
IRAK1 3 1
IRAK4 IRAK4 deficiency, Invasive pneumococcal disease, recurrent, isolated, 1 AR 12 29
IRF2BP2 Immunodeficiency, common variable, 14 AD 1 2
IRF3 Herpes simplex encephalitis, susceptibility to, 7 AD 1 2
IRF4 Skin/hair/eye pigmentation, variation in, 8 AD 1
IRF7 Immunodeficiency 39 AR 2 2
IRF8 Immunodeficiency 32A (CD11C-positive/CD1C-positive dendritic cell deficiency), Immunodeficiency 32B (monocyte and dendritic cell deficiency) AD/AR 4 8
IRF9 1
ISG15 Immunodeficiency, with basal ganglia calcification AR 3 3
ITCH# Autoimmune disease, syndromic multisystem AR 1 1
ITGA2 Fetal and neonatal alloimmune thrombocytopenia AD/AR 5
ITGA2B Glanzmann thrombasthenia AD/AR 22 234
ITGB2 Leukocyte adhesion deficiency AR 33 118
ITGB3 Bleeding disorder, platelet-type 15, Thrombocytopenia, neonatal alloimmune, Glanzmann thrombasthenia AD/AR 18 165
ITK Lymphoproliferative syndrome AR 4 11
JAGN1 Neutropenia, severe congenital AR 8 8
JAK1 Primary immunodeficiency AD/AR 4 6
JAK2 Thrombocythemia 3 AD 12 22
JAK3 Severe combined immunodeficiency, T cell-negative, B cell-positive, natural killer cell-negative AR 30 66
KDM1A Cleft palate, psychomotor retardation, and distinctive facial features AD 5 17
KDM6A Kabuki syndrome XL 40 69
KIF23 Anemia, dyserythropoietic congenital AD 1 3
KLF1 Anemia, dyserythropoietic congenital, Blood group, Lutheran inhibitor, Hereditary persistence of fetal hemoglobin AD/AR 16 45
KMT2A Wiedemann-Steiner syndrome AD 117 114
KMT2D Kabuki syndrome AD 350 670
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LAMTOR2 Immunodeficiency due to defect in MAPBP-interacting protein AR 1 1
LAT Immunodeficiency 52 AR 2 18
LCK Immunodeficiency AR 2 3
LCT Lactase deficiency AR 11 15
LIG1 Autoinflammatory-pancytopenia syndrome AR 3
LIG4 Severe combined immunodeficiency with sensitivity to ionizing radiation, LIG4 syndrome AR 18 36
LIPA Wolman disease, Cholesterol ester storage disease AR 27 93
LPIN2 Majeed syndrome AR 12 14
LRBA Common variable immunodeficiency AR 23 64
LRRC6 Ciliary dyskinesia AR 10 19
LRRC8A Agammaglobulinemia 5 AD 2 2
LYST* Chediak-Higashi syndrome AR 50 97
LZTR1 Schwannomatosis, Noonan syndrome AD/AR 34 71
MAD2L2 Fanconi anemia, complementation group V 1 1
MAGT1 Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95 XL 8 14
MALT1 Immunodeficiency AR 3 5
MAN2B1 Mannosidosis, alpha B, lysosomal AR 63 149
MANBA Mannosidosis, lysosomal AR 16 19
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MAP3K14 Primary immunodeficiency with multifaceted aberrant lymphoid immunity AR 1 2
MAP3K8 Noonan syndrome AD 1
MASP1 3MC syndrome AR 11 22
MASP2 MASP2 deficiency AR 6
MASTL Thrombocytopenia AD 5
MAT2A* Complement system AD/AR 2
MBL2 Mannose-binding protein deficiency AD 2 2
MCIDAS Primary ciliary dyskinesia AR 4 3
MCM4 Natural killer cell and glucocorticoid deficiency with DNA repair defect 1 5
MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27
MEFV Familial Mediterranean fever AD/AR 29 182
MKL1 Primary immunodeficiency AR 4
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MLPH Griscelli syndrome, type 3 AR 4 6
MOGS Congenital disorder of glycosylation AR 7 8
MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55
MPO Myeloperoxidase deficiency AR 12 14
MRAS Noonan syndrome AD 1 2
MRE11A Ataxia-telangiectasia-like disorder-1 AR 57 56
MS4A1 Immunodeficiency, common variable, 5 AR 1 2
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
MSN* Immunodeficiency 50 XL 2 2
MTHFD1 Severe combined immunodeficiency AR 9 11
MVK Mevalonic aciduria, Hyper-IgD syndrome, Porokeratosis 3, multiple types AD/AR 35 181
MYD88 MYD88 deficiency AR 5 5
MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 AD 25 117
MYO5A Griscelli syndrome AR 7 9
MYO5B* Diarrhea, with microvillus atrophy AR 14 80
MYSM1 2 3
NAF1 AD 2
NBAS Infantile liver failure syndrome 2, Short stature, optic nerve atrophy, and Pelger-Huet anomaly (SOPH syndrome) AR 23 43
NBEAL2 Gray platelet syndrome AR 10 51
NBN Breast cancer, Nijmegen breakage syndrome AR 188 97
NCF1#* Chronic granulomatous disease AR 18 44
NCF2 Chronic granulomatous disease AR 19 72
NCF4 Granulomatous disease AR 4 5
NCKAP1L
NCSTN Acne inversa, familial 1 AD 7 30
NEUROG3 Diarrhea, malabsorptive, congenital AR 3 8
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NFAT5 3
NFE2L2 11 6
NFIL3 1
NFKB1 Common variable immunodeficiency AD 8 17
NFKB2 Common variable immunodeficiency AD 6 11
NFKBIA Ectodermal dysplasia, anhidrotic, with T-cell immunodeficiency AD 5 11
NHEJ1 Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation AR 15 16
NHP2 Dyskeratosis congenita AR 5 3
NLRC4 Autoinflammation with infantile enterocolitis (AIFEC), Familial cold autoinflammatory syndrome 4 AD 6 8
NLRP1 Palmoplantar carcinoma, multiple self-healing, Autoinflammation with arthritis and dyskeratosis AD/AR 5 15
NLRP12 Familial cold autoinflammatory syndrome AD 12 12
NLRP3 Neonatal onset multisystem inflammatory disease (NOMID), Muckle-Wells syndrome, Chronic infantile neurologic cutaneous articular (CINCA) syndrome, Familial cold-induced autoinflammatory syndrome 1, Deafness AD 20 136
NME8 Ciliary dyskinesia AR 1 6
NOD2 Blau syndrome, Sarcoidosis, early-onset AD 12 70
NOP10 Dyskeratosis congenita AR 1 1
NRAS Noonan syndrome AD 31 14
NSMCE2 Seckel syndrome 10 3 2
NSMCE3 Lung disease, immunodeficiency, and chromosome breakage syndrome (LICS) AR 2 2
NUP214 AR 1 4
OAS1
OBFC1 2 2
OFD1 Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, Orofaciodigital syndrome, Joubert syndrome XL 153 160
ORAI1 Immunodeficiency, Myopathy, tubular aggregate, 2 AD/AR 9 13
OSTM1 Osteopetrosis, autosomal recessive 5 AR 5 9
OTUD6B Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies (IDDFSDA) AR 6 4
OTULIN Autoinflammation, panniculitis, and dermatosis syndrome (AIPDS) AR 8 3
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PARN* Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 15 29
PAX5 Pre-B cell acute lymphoblastic leukemia AD 7
PEPD Prolidase deficiency AR 12 31
PGM3# Immunodeficiency 23 AR 14 15
PIGA* Multiple congenital anomalies-hypotonia-seizures syndrome XL 24 27
PIH1D3 Ciliary dyskinesia, primary, 36 XL 2 12
PIK3CD* Immunodeficiency AD 6 12
PIK3R1 Agammaglobulinemia, SHORT syndrome AD/AR 33 24
PLCG2 Familial cold autoinflammatory syndrome 3 (PLAID), Autoinflammation, antibody deficiency, and immune dysregulation syndrome (APLAID) AD 7 13
PLEKHM1* Osteopetrosis, autosomal recessive 6, Osteopetrosis AD/AR 3 4
PLG* Plasminogen deficiency, type I, Angioedema AD/AR 10 74
PMM2 Congenital disorder of glycosylation AR 76 128
PMS2#* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
PNP Purine nucleoside phosphorylase deficiency AR 11 33
POLA1 Pigmentary disorder, reticulate, with systemic manifestations, X-linked, Neurodevelopmental disorder 2 1
POLD1 Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency AD/AR 3 31
POLD2
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 8 70
POLE2 Combined immunodeficiency AR 3
POLR3A Leukodystrophy, hypomyelinating AR 29 91
POLR3C 1
POLR3F
POMP Keratosis linearis with ichthyosis congenita and sclerosing keratoderma AR 5 4
POT1 Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 AD 2 34
PPP1CB Noonan syndrome-like disorder with loose anagen hair 2 AD 8 11
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 24 183
PRG4 Camptodactyly-arthropathy-coxa vara-pericarditis syndrome AR 6 35
PRKACG Bleeding disorder, platelet-type, 19 AR 1 1
PRKCD Autoimmune lymphoproliferative syndrome type III AR 4 6
PRKDC Immunodeficiency AR 6 9
PSEN1 Dementia, frontotemporal, Pick disease, Alzheimer disease AD 57 306
PSENEN Acne inversa, familial, 2 AD 7 17
PSMB8 Nakajo-Nishimura syndrome, Chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature syndrome, Autoinflammation, lipodystrophy, and dermatosis syndrome, Joint contractures, muscular atrophy, microcytic anemia, and panniculitis-induced lipodystrophy syndrome AR 5 9
PSMG2
PSTPIP1 Pyogenic sterile arthritis, pyoderma gangrenosum, and acne AD 5 29
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 435 638
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
PTPRC Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive AR 4 5
PTRF Lipodystrophy, congenital generalized AR 9 15
PTX3 Complement system AD/AR 1
PUS1 Mitochondrial myopathy and sideroblastic anemia AR 7 9
RAB27A Griscelli syndrome, Elejalde syndrome AR 18 54
RAC2 Neutrophil immunodeficiency syndrome AD/AR 2 3
RAD50 Nijmegen breakage syndrome-like disorder AR 183 88
RAD51# Mirror movements 2, Fanconi anemia, complementation group R AD 7 10
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 45 53
RAG1 Omenn syndrome, Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity, T cell-negative, B cell-negative, natural killer cell-positive severe combined immunodeficiency, Combined cellular and humoral immune defects with granulomas AR 47 184
RAG2 Omenn syndrome, Combined cellular and humoral immune defects with granulomas AR 28 79
RANBP2* Encephalopathy, acute, infection-induced, 3, susceptibility to AD 41 6
RAP1A 1
RAP1B 1
RASA2 Noonan syndrome AD 1 3
RASGRP1 Primary immunodeficiency AR 1 3
RBCK1 Polyglucosan body myopathy AR 11 14
RBM8A* Thrombocytopenia - absent radius AR 5 12
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
REL# AD/AR
RELA* Autoimmune lymphoproliferative syndrome, Autoinflammatory syndrome, familial, Behcet-like AD 1 3
RELB Immunodeficiency 53 1 1
RFWD3 2 2
RFX5 Bare lymphocyte syndrome AR 4 10
RFXANK MHC class II deficiency AR 8 16
RFXAP Bare lymphocyte syndrome AR 6 9
RHOH T-cell immunodeficiency with epidermodysplasia verruciformis AD/AR 1
RIPK1 Autoinflammatory-pancytopenia syndrome AD/AR 3 1
RIT1 Noonan syndrome AD 23 26
RLTPR Combined immunodeficiency AR 11 8
RMRP Cartilage-hair hypoplasia, Metaphyseal dysplasia without hypotrichosis, Anauxetic dysplasia AR 87 123
RNASEH2A Aicardi-Goutières syndrome AR 13 21
RNASEH2B Aicardi-Goutières syndrome AR 16 41
RNASEH2C Aicardi-Goutières syndrome AR 6 14
RNF168 RIDDLE syndrome AR 4 5
RNF31 HOIP and LUBAC deficiency AR 1
RNU4ATAC Roifman syndrome, Microcephalic osteodysplastic primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3 AR 15 24
RORC Immunodeficiency 42 AR 3 3
RPGR Retinitis pigmentosa, Cone-rod dystrophy, X-linked, 1, Macular degeneration, X-linked atrophic, Retinitis pigmentosa 3 XL 79 218
RPL10 Autism XL 4 5
RPL11 Diamond-Blackfan anemia AD 12 45
RPL15#* Diamond-Blackfan anemia AD 2 2
RPL18
RPL19 1
RPL26 Diamond-Blackfan anemia 11 AD 2 1
RPL27 Diamond-Blackfan anemia 16 1 1
RPL35A Diamond-Blackfan anemia AD 7 14
RPL36 1
RPL5 Diamond-Blackfan anemia AD 19 77
RPL9 2
RPS10 Diamond-Blackfan anemia AD 3 5
RPS14
RPS15 1
RPS15A 1
RPS19 Diamond-Blackfan anemia AD 23 172
RPS24 Diamond-Blackfan anemia AD 6 10
RPS26 Diamond-Blackfan anemia AD 10 33
RPS27 Diamond-Blackfan anemia 17 1 1
RPS27A 1
RPS28 Diamond-Blackfan anemia 15 with mandibulofacial dysostosis AD 1 1
RPS29 Diamond-Blackfan anemia AD 4 4
RPS7 Diamond-Blackfan anemia AD 2 10
RPSA Asplenia, isolated congenital AD 7 8
RRAS Noonan-syndrome like phenotype AD/AR 2
RSPH1 Ciliary dyskinesia AR 14 10
RSPH3 Ciliary dyskinesia, primary, 32 AR 7 5
RSPH4A Ciliary dyskinesia AR 18 24
RSPH9 Ciliary dyskinesia AR 8 12
RTEL1 Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 58 51
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SAMD9 Mirage syndrome, Tumoral calcinosis, normophosphatemic AD/AR 10 27
SAMD9L Ataxia-pancytopenia syndrome AD 4 16
SAMHD1 Aicardi-Goutières syndrome, Chilblain lupus 2 AD/AR 25 56
SAR1B Chylomicron retention disease (Anderson disease) AR 8 16
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AR 19 90
SBF2 Charcot-Marie-Tooth disease AR 25 21
SEC23B Anemia, dyserythropoietic congenital AR 18 121
SEC61A1 Hyperuricemic nephropathy, familial juvenile 4 AD 4 4
SEMA3E CHARGE syndrome AD 1 4
SERPING1 Angioedema, Complement component 4, partial deficiency of AD/AR 34 563
SH2D1A Lymphoproliferative syndrome XL 21 129
SH3BP2 Cherubism AD 9 16
SH3KBP1 2 1
SHOC2 Noonan-like syndrome with loose anagen hair AD 2 4
SI Sucrase-isomaltase deficiency, congenital AR 12 23
SKIV2L Trichohepatoenteric syndrome 2 AR 6 33
SLC10A2 Bile acid malabsorption, primary AD/AR 2 4
SLC19A2 Thiamine-responsive megaloblastic anemia syndrome AR 14 51
SLC25A38 Anemia, sideroblastic 2, pyridoxine-refractory AR 7 27
SLC26A3 Diarrhea, secretory chloride, congenital AR 55 88
SLC29A3 Histiocytosis-lymphadenopathy plus syndrome, Dysosteosclerosis AR 17 25
SLC35A1 Congenital disorder of glycosylation AR 4 5
SLC35C1 Congenital disorder of glycosylation, Leukocyte adhesion deficiency AR 6 7
SLC37A4 Glycogen storage disease AD/AR 49 113
SLC39A4 Acrodermatitis enteropathica AR 13 50
SLC39A7 Agammaglobulinemia AR
SLC46A1 Folate malabsorption AR 17 23
SLC5A1 Glucose/galactose malabsorption AR 3 58
SLC7A7 Lysinuric protein intolerance AR 55 67
SLC9A3 Diarrhea, secretory sodium, congenital AR 6 12
SLFN14 Thrombocytopenia AD 4 4
SLX4 Fanconi anemia AR 18 72
SMARCAL1 Schimke immunoosseous dysplasia AR 20 88
SMARCD2 Specific granule defiency 2 AR 3 1
SNX10 Osteopetrosis, autosomal recessive 8 AR 3 13
SOS1 Noonan syndrome AD 44 71
SOS2 Noonan syndrome 9 AD 4 6
SP110 Hepatic venoocclusive disease with immunodeficiency AR 8 8
SPAG1 Primary ciliary dyskinesia AR 18 11
SPINK5 Netherton syndrome AR 29 85
SPINT2 Diarrhea, secretory sodium, congenital AR 6 12
SPPL2A Autoinflammatory-pancytopenia syndrome AR 1
SPRED1 Legius syndrome AD 38 71
SRC Thrombocytopenia, autosomal dominant, 6 AD 2 1
SRP54 Shwachman-Diamond syndrome AD 3
SRP72* Bone marrow failure syndrome 1 AD 2 5
STAT1 Immunodeficiency AD/AR 39 122
STAT2 Immunodeficiency AR 3 6
STAT3 Hyper-IgE recurrent infection syndrome, Autoimmune disease, multisystem, infantile onset AD 47 152
STAT5B* Growth hormone insensitivity with immunodeficiency AD/AR 9 13
STIM1 Stormorken syndrome, Immunodeficiency, Myopathy, tubular aggregate 1 AD/AR 13 24
STK36 Primary ciliary dyskinesia AR 5
STK4 T-cell immunodeficiency syndrome, recurrent infections, autoimmunity, AR 3 7
STX11 Hemophagocytic lymphohistiocytosis, familial AR 8 22
STX3 Microvillus inclusion disease AR 3
STXBP2 Hemophagocytic lymphohistiocytosis, familial AR 12 77
STXBP3 1
TAP1 Bare lymphocyte syndrome AR 1 7
TAP2 Bare lymphocyte syndrome AR 4 8
TAPBP Bare lymphocyte syndrome AR 1 2
TASP1 1 1
TAZ 3-Methylglutaconic aciduria, (Barth syndrome) XL 45 158
TBK1 Herpes simplex encephalitis, Frontotemporal dementia and/or amyotrophic lateral sclerosis 4 AD 11 133
TBX1 Conotruncal anomaly face syndrome AD 17 72
TCF3 Agammaglobulinemia 8, autosomal dominant AD 1 5
TCIRG1 Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 48 130
TCN2 Transcobalamin II deficiency AR 9 35
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERF2 2
TERF2IP 6
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
TFRC Immunodeficiency 46 AR 8 2
TGFB1 Diaphyseal dysplasia Camurati-Engelmann, Inflammatory bowel disease AD/AR 15 23
TGFBR1 Loeys-Dietz syndrome AD 40 69
TGFBR2 Loeys-Dietz syndrome AD 58 139
THBD Thrombophilia due to thrombomodulin defect, Hemolytic uremic syndrome, atypical AD 5 28
THPO Thrombocythemia 1 AD/AR 5 10
THRA Hypothyroidism, congenital, nongoitrous, 6 AD 8 13
THRB Thyroid hormone resistance AD/AR 61 165
TICAM1 Herpes simplex encephalitis, susceptibility to, 4 AD/AR 4
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TIRAP AD/AR 1
TLR3 Herpes simplex encephalitis, susceptibility to, 2 AD/AR 14
TMC6 Epidermodysplasia verruciformis AR 8 7
TMC8 Epidermodysplasia verruciformis AR 3 9
TMEM173 STING-associated vasculopathy, infantile-onsent (SAVI) AD/AR 4 10
TNFAIP3 Autoinflammatory syndrome, familial, Behcet-like AD 8 23
TNFRSF11A Familial expansile osteolysis, Paget disease of bone, Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 8 24
TNFRSF13B Common variable immunodeficiency, Immunoglobulin A deficiency AD/AR 7 48
TNFRSF13C Immunodeficiency, common variable 4 AR 1 3
TNFRSF1A# Periodic fever (TNF receptor-associated periodic syndrome) AD 19 106
TNFRSF4 Immunodeficiency AR 1 1
TNFRSF9 Immunodeficiency AR
TNFSF11 Osteopetrosis, autosomal recessive 2 AR 3 5
TNFSF12 1
TOP2B AD 1 1
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
TPP2 1 1
TRAC T-cell receptor-alpha/beta deficiency AR 1 1
TRADD 3
TRAF3 Herpes simplex encephalitis, susceptibility to, 3 AD 1 1
TRAF3IP2 Candidiasis, familial 8 AR 1 3
TREX1 Vasculopathy, retinal, with cerebral leukodystrophy, Chilblain lupus, Aicardi-Goutières syndrome AD/AR 30 71
TRIM22 4
TRNT1 Retinitis pigmentosa and erythrocytic microcytosis, Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay AR 13 26
TSR2 Diamond-Blackfan anemia 14 with mandibulofacial dysostosis XL 3 2
TTC37 Trichohepatoenteric syndrome, Autoinflammatory-pancytopenia syndrome AR 12 64
TTC7A Gastrointestinal defects and immunodeficiency syndrome AR 21 46
TUBB1 Macrothrombocytopenia AD 2 7
TYK2 Immunodeficiency AR 9 9
UBE2T Fanconi anemia, complementation group T AR 2 7
UNC119 Immunodeficiency, Cone-rod dystrophy 2 AD 1 5
UNC13D Hemophagocytic lymphohistiocytosis, familial AR 22 192
UNC93B1* Herpes simplex encephalitis, susceptibility to, 1 AR 2
UNG Immunodeficiency with hyper-IgM, type 5 AR 6 7
USB1 Poikiloderma with neutropenia AR 24 22
USP18#* Pseudo-TORCH syndrome 2 AR 40 1
VPS13B Cohen syndrome AR 351 203
VPS45# Neutropenia, severe congenital, 5, autosomal recessive AR 3 4
VSIG4 Complement system XL 2
VTN Complement system AD/AR
WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome XL 57 439
WDR1 AR 8
WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3
WRAP53 Dyskeratosis congenita AR 7 6
XIAP* Lymphoproliferative syndrome XL 14 96
XRCC2 Hereditary breast cancer AD/AR 10 21
ZAP70 Selective T-cell defect AR 15 29
ZBTB24 Immunodeficiency-Centromeric Instability-Facial Anomalies 2 AR 7 17
ZCCHC8 1
ZMYND10 Ciliary dyskinesia AR 8 16
ZNF341* AR 5
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Immune and Cytopenia Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ADA Chr20:43248503 c.1079-15T>A NM_000022.2 rs387906268
ADA Chr20:43249076 c.976-34G>A NM_000022.2
ALAS2 ChrX:55054634 c.-15-2186C>G NM_000032.4
ALAS2 ChrX:55054635 c.-15-2187T>C NM_000032.4
ALAS2 ChrX:55054636 c.-15-2188A>G NM_000032.4
ALAS2 ChrX:55057393 c.-34C>T NM_000032.4 rs780642606
ALAS2 ChrX:55057617 c.-258C>G NM_000032.4 rs140772352
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
BTK ChrX:100609705 c.1567-23A>G NM_000061.2
BTK ChrX:100609705 c.1567-23A>C NM_000061.2
BTK ChrX:100612468 c.1177+28_1177+29insAGAAAAAAGGT NM_000061.2
BTK ChrX:100613695 c.895-11C>A NM_000061.2
BTK ChrX:100625094 c.310-28_310-27delGCinsTG NM_000061.2
BTK ChrX:100629415 c.240+109C>A NM_000061.2
BTK ChrX:100629416 c.240+108T>G NM_000061.2
BTK ChrX:100629827 c.142-205A>G NM_000061.2
BTK ChrX:100630121 c.141+11C>T NM_000061.2 rs138411530
BTK ChrX:100641044 c.-31+6T>G NM_000061.2
BTK ChrX:100641045 c.-31+5G>A NM_000061.2
BTK ChrX:100641045 c.-31+5G>T NM_000061.2 rs1131691354
BTK ChrX:100641045 c.-31+5G>C NM_000061.2
BTK ChrX:100641049 c.-31+1G>A NM_000061.2
BTK ChrX:100641049 c.-31+1G>C NM_000061.2
BTK ChrX:100641050 c.-31G>A NM_000061.2
BTK ChrX:100641212 c.-193A>G NM_000061.2
C1QB Chr1:22985931 c.-17-2A>C NM_000491.3
C7 Chr5:40931143 c.63-23T>A NM_000587.2 rs772462732
CCDC39 Chr3:180365042 c.1363-11A>G NM_181426.1
CCDC39 Chr3:180367928 c.1167+1261A>G NM_181426.1 rs577069249
CCDC39 Chr3:180367941 c.1167+1248A>G NM_181426.1
CD40LG ChrX:135736498 c.289-32_289-25delAAAATGAC NM_000074.2
CD40LG ChrX:135736517 c.289-15T>A NM_000074.2
CD40LG ChrX:135737600 c.347-915A>T NM_000074.2
CD46 Chr1:207930564 c.286+27delT NM_002389.4 rs771669828
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
CECR1 Chr22:17664763 c.1082-1113delA NM_017424.2
CFTR Chr7:117119654 c.-495C>T NM_000492.3 rs397507565
CFTR Chr7:117119797 NM_000492.3
CFTR Chr7:117119900 c.-249G>C NM_000492.3
CFTR Chr7:117119984 c.-165G>A NM_000492.3 rs145483167
CFTR Chr7:117120064 c.-85C>G NM_000492.3
CFTR Chr7:117120115 c.-34C>T NM_000492.3 rs756314710
CFTR Chr7:117120325 c.53+124T>C NM_000492.3
CFTR Chr7:117179040 c.870-1113_870-1110delGAAT NM_000492.3 rs397508809
CFTR Chr7:117182041 c.1117-26_1117-25delAT NM_000492.3 rs397508159
CFTR Chr7:117199500 c.1393-18G>A NM_000492.3 rs397508199
CFTR Chr7:117227774 c.1585-19T>C NM_000492.3 rs778457306
CFTR Chr7:117227921 c.1679+34G>T NM_000492.3 rs767901668
CFTR Chr7:117229521 c.1680-886A>G NM_000492.3 rs397508266
CFTR Chr7:117229524 c.1680-883A>G NM_000492.3
CFTR Chr7:117229530 c.1680-877G>T NM_000492.3 rs397508261
CFTR Chr7:117243855 c.2908+19G>C NM_000492.3 rs370683572
CFTR Chr7:117246713 c.2909-15T>G NM_000492.3 rs397508455
CFTR Chr7:117246840 c.2988+33G>T NM_000492.3
CFTR Chr7:117251609 c.3140-26A>G NM_000492.3 rs76151804
CFTR Chr7:117251619 c.3140-16T>A NM_000492.3 rs767232138
CFTR Chr7:117251624 c.3140-11A>G NM_000492.3
CFTR Chr7:117266272 c.3469-1304C>G NM_000492.3
CFTR Chr7:117267864 c.3717+40A>G NM_000492.3 rs397508595
CFTR Chr7:117280015 c.3718-2477C>T NM_000492.3 rs75039782
CFTR Chr7:117282680 c.3873+33A>G NM_000492.3 rs397508622
CFTR Chr7:117288374 c.3874-4522A>G NM_000492.3
CHD7 Chr8:61734568 c.2836-15C>G NM_017780.3
CHD7 Chr8:61757794 c.5051-15T>A NM_017780.3
CHD7 Chr8:61763034 c.5405-18C>A NM_017780.3 rs199981784
CHD7 Chr8:61763035 c.5405-17G>A NM_017780.3 rs794727423
CHD7 Chr8:61763039 c.5405-13G>A NM_017780.3 rs1131690787
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
COG6 Chr13:40273614 c.1167-24A>G NM_020751.2 rs730882236
CREBBP Chr16:3788684 c.4281-11C>G NM_004380.2 rs587783493
CTSC Chr11:88070895 c.-55C>A NM_001814.4 rs766114323
CYBA Chr16:88712620 c.288-15C>G NM_000101.3
CYBB ChrX:37639262 c.-69A>C NM_000397.3
CYBB ChrX:37639262 NM_000397.3
CYBB ChrX:37639264 c.-67T>C NM_000397.3
CYBB ChrX:37639266 c.-65C>T NM_000397.3
CYBB ChrX:37639267 c.-64C>T NM_000397.3
CYBB ChrX:37641327 c.46-14_46-11delTTCTinsGAA NM_000397.3
CYBB ChrX:37641330 c.46-11T>G NM_000397.3
CYBB ChrX:37642713 c.142-28_142-12delACTCTGCTCCCTTTCCC NM_000397.3
CYBB ChrX:37642731 c.142-12delCinsACCTCTTCTAG NM_000397.3
CYBB ChrX:37654041 c.483+978G>T NM_000397.3
CYBB ChrX:37656474 c.674+1080A>G NM_000397.3
CYBB ChrX:37656731 c.674+1337T>G NM_000397.3
CYBB ChrX:37657051 c.675-1157A>G NM_000397.3
CYBB ChrX:37664248 c.1152-11T>G NM_000397.3
DGKE Chr17:54925466 c.888+40A>G NM_003647.2
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
DNMT3B Chr20:31395557 c.2421-11G>A NM_006892.3 rs547940069
DOCK8 Chr9:317025 c.742-18C>G NM_203447.3 rs112373444
DOCK8 Chr9:317028 c.742-15T>G NM_203447.3 rs111627162
DOCK8 Chr9:368196 c.1797+61A>C NM_203447.3 rs786205596
EP300 Chr22:41537040 c.1879-12A>G NM_001429.3
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
FANCA Chr16:89805127 c.4261-19_4261-12delACCTGCTC NM_000135.3
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FANCD2 Chr3:10083186 c.696-121C>G NM_033084.3
FANCD2 Chr3:10102127 c.1766+40T>G NM_033084.3
FANCD2 Chr3:10106024 c.1948-16T>G NM_033084.3
FANCI Chr15:89825208 c.1583+142C>T NM_001113378.1
FANCL Chr2:58433394 c.375-2033C>G NM_001114636.1
FAS Chr10:90770494 c.506-16A>G NM_000043.4
FASLG Chr1:172628081 c.-261T>C NM_000639.1
FERMT1 Chr20:6074846 c.1139+740G>A NM_017671.4 rs869312728
FERMT1 Chr20:6103422 c.-20A>G NM_017671.4 rs869312722
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
FOXP3 ChrX:49121118 c.-23+5G>A NM_014009.3
FOXP3 ChrX:49121121 c.-23+2T>G NM_014009.3
FOXP3 ChrX:49121122 c.-23+1G>A NM_014009.3
FOXP3 ChrX:49121122 c.-23+1G>T NM_014009.3
GATA1 ChrX:48649496 c.-19-2A>G NM_002049.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GBA Chr1:155205646 c.1225-14_1225-11delTGTCinsAGT NM_000157.3
GBA Chr1:155208109 c.589-12C>G NM_000157.3
GBA Chr1:155211053 c.-150A>G NM_000157.3 rs1232943445
GINS1 Chr20:25388397 c.-60A>G NM_021067.3
GINS1 Chr20:25388409 c.-48C>G NM_021067.3
HNRNPK Chr9:86590455 c.214-35A>G NM_002140.3
HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096
IL10RB Chr21:34668714 c.*52C>T NM_000628.4
IL2RG ChrX:70327277 c.*307_*308delAA NM_000206.2
IL2RG ChrX:70327278 c.*308A>G NM_000206.2
IL2RG ChrX:70330553 c.270-15A>G NM_000206.2
IL7R Chr5:35867853 c.379+288G>A NM_002185.3
ITGA2B Chr17:42449567 c.*165T>C NM_000419.3
ITGA2B Chr17:42455177 c.2095-19T>A NM_000419.3
ITGA2B Chr17:42458507 c.1211-78A>G NM_000419.3
ITGA2B Chr17:42463181 c.408+11C>A NM_000419.3
ITGA2B Chr17:42470923 c.-4082G>A NM_000419.3
ITGB2 Chr21:46320404 c.742-14C>A NM_000211.3 rs183204825
ITGB2 Chr21:46321660 c.500-12T>G NM_000211.3
JAK3 Chr19:17943239 c.2680+89G>A NM_000215.3
JAK3 Chr19:17946035 c.1915-11G>A NM_000215.3
KLF1 Chr19:12998078 c.-124T>C NM_006563.3
KLF1 Chr19:12998102 NM_006563.3 rs552824864
KLF1 Chr19:12998108 c.-154C>T NM_006563.3 rs372651309
KMT2D Chr12:49428461 c.10356-12G>A NM_003482.3
LAMTOR2 Chr1:156028185 c.*23C>A NM_014017.3
LZTR1 Chr22:21336623 c.-38T>A NM_006767.3
LZTR1 Chr22:21350968 c.2220-17C>A NM_006767.3 rs1249726034
MEFV Chr16:3306599 c.-12C>G NM_000243.2 rs104895148
MEFV Chr16:3306969 c.-382C>G NM_000243.2
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
MVK Chr12:110029032 c.769-7dupT NM_000431.2 rs104895348
MYO5B Chr18:47365503 c.4852+11A>G NM_001080467.2
NBAS Chr2:15567431 c.2423+404G>C NM_015909.3
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
OFD1 ChrX:13768358 c.935+706A>G NM_003611.2 rs730880283
OFD1 ChrX:13773245 c.1130-22_1130-19delAATT NM_003611.2 rs312262865
OFD1 ChrX:13773249 c.1130-20_1130-16delTTGGT NM_003611.2
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PARN Chr16:14724045 c.-165+2C>T NM_001134477.2
PMM2 Chr16:8891573 NM_000303.2
PMM2 Chr16:8898599 c.179-25A>G NM_000303.2 rs760689221
PMM2 Chr16:8926102 c.640-15479C>T NM_000303.2 rs1258107584
PMM2 Chr16:8941558 c.640-23A>G NM_000303.2
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
PNP Chr14:20942914 c.286-18G>A NM_000270.3
POLA1 ChrX:24744696 c.1375-354A>G NM_016937.3 rs869312979
POLE Chr12:133249181 c.1686+32C>G NM_006231.2 rs762985435
POLR3A Chr10:79737218 c.*18C>T NM_007055.3
POLR3A Chr10:79743781 c.3337-11T>C NM_007055.3
POLR3A Chr10:79769273 c.1909+22G>A NM_007055.3 rs191875469
POLR3A Chr10:79769277 c.1909+18G>A NM_007055.3 rs267608677
POMP Chr13:29233225 c.-95delC NM_015932.5 rs112368783
PSEN1 Chr14:73673071 c.869-23_869-22insTGGAATTTTGTGCTGTTG NM_000021.3
PSENEN Chr19:36236501 c.-192_-190delAGA NM_172341.2 rs554724520
PTEN Chr10:89622883-89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623392 c.-835C>T NM_000314.4 rs587779994
PTEN Chr10:89623428 c.-799G>C NM_000314.4 rs587779992
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89690791 c.210-8dupT NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTEN Chr10:89725294 c.*65T>A NM_000314.4
PTEN Chr10:89725304 c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG NM_000314.4
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RAG2 Chr11:36619652 c.-28G>C NM_000536.3
RBM8A Chr1:145507646 c.-21G>A NM_005105.4
RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890
RFXANK Chr19:19307761 c.188-11C>T NM_003721.3 rs201545133
RMRP Chr9:35658026 NR_003051.3 rs781730798
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3 rs727502775
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658032 NR_003051.3
RNASEH2B Chr13:51501530 c.65-13G>A NM_024570.3
RNASEH2B Chr13:51519550 c.511-13G>A NM_024570.3
RPGR ChrX:38128234 NM_000328.2
RPGR ChrX:38160137 c.1059+363G>A NM_001034853.1
RPL5 Chr1:93300322 c.190-12_191dupCTCTTACTATAGAT NM_000969.3
RPS19 Chr19:42364214 c.-144_-141delTTTC NM_001022.3
RPS26 Chr12:56436176 c.4-25_4-14delTAACAGTTTTCC NM_001029.3
RPS7 Chr2:3622941 c.-19+1G>T NM_001011.3
RPS7 Chr2:3622942 c.-19+2T>C NM_001011.3
RPSA Chr3:39448260 c.-34+5G>C NM_002295.4
SEC23B Chr20:18488060 c.-571A>G NM_006363.4 rs559854357
SEC23B Chr20:18488615 c.-16A>G NM_006363.4
SEC23B Chr20:18491731 c.221+31A>G NM_006363.4
SEC23B Chr20:18491863 c.221+163A>G NM_006363.4 rs573898514
SEC23B Chr20:18492791 c.222-78C>T NM_006363.4 rs150393520
SEC23B Chr20:18526845 c.1743+168A>G NM_006363.4 rs111951711
SERPING1 Chr11:57365055 c.-163C>T NM_000062.2
SERPING1 Chr11:57365057 c.-161A>G NM_000062.2
SERPING1 Chr11:57365118 c.-100C>G NM_000062.2 rs578018379
SERPING1 Chr11:57365720 c.-22-2A>C NM_000062.2
SERPING1 Chr11:57365720 c.-22-2A>G NM_000062.2
SERPING1 Chr11:57365721 c.-22-1G>A NM_000062.2
SERPING1 Chr11:57373471 c.686-12A>G NM_000062.2
SERPING1 Chr11:57373867 c.890-14C>G NM_000062.2
SERPING1 Chr11:57381788 c.1250-13G>A NM_000062.2
SH2D1A ChrX:123499593 c.138-17_138-11delAGTTTAT NM_002351.4
SLC29A3 Chr10:73122778 c.*413G>A NM_018344.5
SLC39A4 Chr8:145641963 c.192+19G>A NM_130849.3 rs368996660
SPINK5 Chr5:147465956 c.283-12T>A NM_006846.3
SPINK5 Chr5:147484503 c.1431-12G>A NM_006846.3 rs368134354
SPINK5 Chr5:147491511 c.1820+53G>A NM_006846.3 rs754599628
STX11 Chr6:144508713 c.*85_*86insT NM_003764.3
STXBP2 Chr19:7705761 c.326-23_326-16delGCCCCACT NM_006949.3
TAZ ChrX:153641699 n.694+4G>A NR_024048.1
TAZ ChrX:153649161 c.778-63_778-51delCTCCCAGGGCACC NM_000116.3 rs782249471
TBX1 Chr22:19743578 c.-777C>T NM_080647.1
TBX1 Chr22:19743735 c.-620A>C NM_080647.1 rs536892777
TCIRG1 Chr11:67806587 c.-5+1G>C NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>T NM_006019.3
TCIRG1 Chr11:67816893 c.1887+132T>C NM_006019.3
TCIRG1 Chr11:67816903 c.1887+142T>A NM_006019.3
TCIRG1 Chr11:67816907 c.1887+146G>A NM_006019.3
TCIRG1 Chr11:67816910 c.1887+149C>T NM_006019.3
TCN2 Chr22:31011112 c.581-176A>T NM_000355.3
TCN2 Chr22:31011112 c.581-176A>G NM_000355.3 rs372866837
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
THBD Chr20:23030319 NM_000361.2
THBD Chr20:23030443 c.-302C>A NM_000361.2
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TRNT1 Chr3:3188088 c.609-26T>C NM_182916.2
TTC7A Chr2:47249223 c.1510+105T>A NM_020458.2
UNC13D Chr17:73826245 c.2831-13G>A NM_199242.2
UNC13D Chr17:73827442 c.2448-13G>A NM_199242.2 rs753762300
UNC13D Chr17:73839907 c.118-307G>A NM_199242.2
UNC13D Chr17:73839908 c.118-308C>T NM_199242.2
WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2
ZAP70 Chr2:98349927 c.838-80G>A NM_001079.3 rs113994173
ZAP70 Chr2:98354447 c.1624-11G>A NM_001079.3 rs730880318

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ARMC4 NM_001290021.2:13;NM_018076.5:9, C5 NM_001317164.2:21, CD55 NM_001300902.2:10;NM_001300903.2:10, CHEK2 NM_001005735.2:3, CORO1A NM_007074.4:11, CSF2RA NM_001161530.2:11, HYDIN NM_001270974.2:6,8,12,18,20,21,23,26,27,31,35,37,45,47,50,52,57,58,64,70,75,78,82,83, IL12RB1 NM_153701.3:10, IL6R NM_001206866.2:7, ITCH NM_001257137.3:7, NCF1 NM_000265.7:1,5,8,9,11, PGM3 NM_001199919.2:14, PMS2 NM_000535.7:13-15, RAD51 NM_133487.4:4, REL NM_002908.4:9, RPL15 NM_001253384.2:5, TNFRSF1A NM_001346092.2:6, USP18 NM_017414.4:11, VPS45 NM_001279353.2:13. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Small deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

We utilize whole exome capture technology and Next-Generation Sequencing methods to obtain clinical-grade WES data, maximizing coverage of clinically relevant genes. The performance metrics listed below are from validation performed at our laboratory in Finland.

  • Highly uniform sequencing depth across all protein-coding genes of the genome
        • Mean sequencing coverage on average 154x at 100M sequenced reads
        • On average, 99.6% of base pairs in target region is covered at least 20x 
          • Target region: protein coding exons extending ±20 base pairs to intron-exon boundaries and ~2,000 intronic regions know to contain medically relevant variants 
  • Highly sensitive and specific detection of single-nucleotide variants and indels (GIAB 4.2.1)
    • 99.1% (99.8%*) sensitivity and >99.99% specificity for detecting single-nucleotide variants within target region
    • 95.0% (94.5%*) sensitivity and >99.99% specificity for indel (≤ 50 bps) detection within target region
      • Range of detected indels in validation: Deletions up to 1-245bp detected, insertions 1-200bp 
    • Assay performs with high precision
      • Within-run precision (repeatability) 99.1%, intermediate precision (reproducibility) 99.0%
  • Sensitive and specific detection of copy number variants (CNVs)
      • Values indicated with * were generated using previous version (v3.3.2) of benchmark data. Version 4.2.1 is extended to included challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information see https://doi.org/10.1016/j.xgen.2022.100128In validation single exon deletion (and larger) events were detected at 100% sensitivity.Segmentally duplicated genomic regions may have reduced sensitivity. The exact boundaries of the copy number aberration cannot be determined with this test

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using latest version of high-confidence benchmark data provided byGenome in a Bottle (v4.2.1).

Values indicated with * were generated using previous version (v3.3.2) of benchmark data. Version 4.2.1 is extended to included challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information see https://doi.org/10.1016/j.xgen.2022.100128

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.