Comprehensive Immune and Cytopenia Panel
It is ideal for patients with hematologic and/or immunologic presentations.
- PLUS
Summary
The Blueprint Genetics Comprehensive Immune and Cytopenia Panel (test code IM0902):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
Immunological and hematological disorders may present with variable overlapping manifestations. As clinical findings may be unspecific, having to select 1 or more smaller gene panels based on a patient’s symptoms can delay the identification of the disease-causing genetic alterations and optimal disease management. To enable a fast and accurate diagnosis, this panel covers a broad range of immuno-hematologic disorders including: primary immunodeficiency, bone marrow failure, complement disorders, autoinflammatory disorders, neutropenia, and thrombocytopenia.
Genes in the Comprehensive Immune and Cytopenia Panel and their clinical significance
To view complete table content, scroll horizontally.
| Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
|---|---|---|---|---|
| ABCB7 | Anemia, sideroblastic, and spinocerebellar ataxia | XL | 8 | 9 |
| ABCG5 | Sitosterolemia | AR | 13 | 42 |
| ABCG8 | Sitosterolemia | AR | 18 | 44 |
| ACD | Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7 | AD/AR | 2 | 8 |
| ACP5 | Spondyloenchondrodysplasia with immune dysregulation | AR | 12 | 26 |
| ACTB* | Baraitser-Winter syndrome | AD | 55 | 60 |
| ACTG1* | Deafness, Baraitser-Winter syndrome | AD | 27 | 47 |
| ACTN1 | Bleeding disorder, platelet-type 15 | AD | 7 | 25 |
| ADA | Severe combined immunodeficiency due to adenosine deaminase deficiency | AR | 49 | 93 |
| ADAM17 | Inflammatory skin and bowel disease, neonatal 1 | AR | 1 | 7 |
| ADAMTS13 | Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, familial | AR | 30 | 183 |
| ADAMTS3 | Hennekam lymphangiectasia-lymphedema syndrome | AR | 1 | 3 |
| ADAR | Dyschromatosis symmetrica hereditaria, Aicardi-Goutières syndrome | AD/AR | 25 | 226 |
| ADIPOQ | Complement system | AD/AR | 2 | 8 |
| ADIPOR1* | Complement system | AD/AR | 4 | |
| ADIPOR2 | Complement system | AD/AR | 1 | 1 |
| AICDA | Immunodeficiency with hyper-IgM | AD/AR | 14 | 50 |
| AIRE | Autoimmune polyendocrinopathy syndrome | AD/AR | 73 | 134 |
| AK2 | Reticular dysgenesis | AR | 14 | 17 |
| ALAS2 | Anemia, sideroblastic, Protoporphyria, erythropoietic | XL | 27 | 103 |
| ALPI | Inflammatory bowel disease | AR | 5 | |
| ANKRD11* | KBG syndrome | AD | 142 | 132 |
| ANKRD26 | Thrombocytopenia | AD | 6 | 21 |
| AP1S3 | Psoriasis 15, pustular, susceptibility to | AD | 6 | |
| AP3B1 | Hermansky-Pudlak syndrome | AR | 14 | 34 |
| AP3D1 | Hermansky-Pudlak syndrome 10 | AR | 1 | 4 |
| APOL1* | Sporadic idiopathic steroid-resistant nephrotic syndrome with focal segmental hyalinosis | AD/AR | 1 | |
| ARHGEF1 | Idiopathic bronchiectasis, Immunodeficiencies with antibody defects | AR | 1 | |
| ARMC4#* | Ciliary dyskinesia | AR | 18 | 17 |
| ARPC1B | Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease | AR | 2 | 4 |
| ATM | Breast cancer, Ataxia-Telangiectasia | AD/AR | 1047 | 1109 |
| ATP6AP1 | Immunodeficiency 47 | XL | 5 | 5 |
| ATR | Cutaneous telangiectasia and cancer syndrome, Seckel syndrome | AD/AR | 10 | 33 |
| ATRX | Carpenter-Waziri syndrome, Alpha-thalassemia/mental retardation syndrome, Holmes-Gang syndrome, Juberg-Marsidi syndrome, Smith-Fineman-Myers syndrome, Mental retardation-hypotonic facies syndrome | XL | 65 | 165 |
| B2M | Amyloidosis, systemic visceral | AR | 8 | 4 |
| BACH2 | BACH2-related immunodeficiency and autoimmunity (BRIDA) | AD | 2 | |
| BCL10 | Immunodeficiency 37 | AR | 16 | 1 |
| BCL11B | Immunodeficiency 49 | AD | 8 | 12 |
| BCO1 | Hypercarotenemia and vitamin A deficiency, autosomal dominant | AD/AR | 1 | 2 |
| BLM | Bloom syndrome | AR | 152 | 119 |
| BLNK | Agammaglobulinemia 4 | AR | 2 | 3 |
| BLOC1S3 | Hermansky-Pudlak syndrome | AR | 2 | 4 |
| BLOC1S6 | Hermansky-Pudlak syndrome | AR | 1 | 2 |
| BRAF* | LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome | AD | 134 | 65 |
| BRCA1* | Pancreatic cancer, Breast-ovarian cancer, familial, Fanconi anemia | AD/AR | 2997 | 2631 |
| BRCA2 | Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial | AD/AR | 3369 | 2659 |
| BRIP1 | Fanconi anemia, Ovarian cancer, familial | AD/AR | 238 | 189 |
| BTK | Hypogammaglobulinemia, Agammaglobulinemia and isolated hormone deficiency, Agammaglobulinemia | XL | 114 | 908 |
| C11ORF70 | Primary ciliary dyskinesia | AR | 5 | |
| C15ORF41 | Congenital dyserythropoietic anemia | AR | 3 | 3 |
| C17ORF62 | Chronic granulomatous disease | AR | 1 | |
| C1QA | C1q deficiency | AR | 2 | 7 |
| C1QB | C1q deficiency | AR | 4 | 8 |
| C1QBP | Primary immunodeficiency | AD/AR | 6 | 7 |
| C1QC | C1q deficiency | AR | 4 | 10 |
| C1R | Ehlers-Danlos syndrome, periodontal type 1 | AD/AR | 15 | 17 |
| C1S | Complement component C1s deficiency | AD/AR | 4 | 10 |
| C2* | Complement component 2 deficiency | AR | 4 | 9 |
| C21ORF59 | Ciliary dyskinesia | AR | 5 | 4 |
| C3 | Hemolytic uremic syndrome, atypical, Complement component 3 deficiency, Macular degeneration, age-related | AD/AR | 6 | 87 |
| C3AR1 | Complement system | AD/AR | 1 | 4 |
| C4BPA | Complement system | AD/AR | 4 | |
| C4BPB | Complement system | AD/AR | 1 | |
| C5# | Eculizumab, poor response to, Complement component 5 deficiency | AD/AR | 6 | 18 |
| C5AR1 | Complement system | AD/AR | ||
| C5AR2 | Complement system | AD/AR | 2 | |
| C6 | Complement component 6 deficiency | AR | 8 | 12 |
| C7 | Complement component 7 deficiency | AR | 14 | 31 |
| C8A | Complement component 8 deficiency | AR | 2 | 8 |
| C8B | Complement component 8 deficiency | AR | 7 | 8 |
| C8G | Immunodeficiency | AD/AR | ||
| C9 | Complement component 9 deficiency | AR | 7 | 9 |
| CARD11 | B-cell expansion with NFKB and T-cell anergy, Immunodeficiency | AD/AR | 12 | 9 |
| CARD14 | Psoriasis | AD | 9 | 29 |
| CARD9 | Candidiasis, familial, 2 | AR | 8 | 25 |
| CASP10 | Autoimmune lymphoproliferative syndrome | AD | 5 | 7 |
| CASP8 | Caspase 8 defiency | AR | 2 | 7 |
| CBL | Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia | AD | 24 | 43 |
| CCBE1 | Hennekam lymphangiectasia-lymphedema syndrome | AR | 6 | 13 |
| CCDC103 | Ciliary dyskinesia | AR | 4 | 5 |
| CCDC114 | Ciliary dyskinesia, primary, 20 | AR | 9 | 8 |
| CCDC39 | Ciliary dyskinesia | AR | 39 | 47 |
| CCDC40 | Ciliary dyskinesia | AR | 33 | 43 |
| CCDC65 | Ciliary dyskinesia | AR | 2 | 2 |
| CCNK | AD | |||
| CCNO | Ciliary dyskinesia | AR | 11 | 10 |
| CD19 | Immunodeficiency, common variable | AR | 8 | 9 |
| CD247 | Immunodeficiency | AR | 8 | 4 |
| CD27 | Lymphoproliferative syndrome | AR | 4 | 8 |
| CD3D | Immunodeficiency | AR | 3 | 5 |
| CD3E | Immunodeficiency | AR | 4 | 7 |
| CD3G | Immunodeficiency | AR | 5 | 3 |
| CD40 | Immunodeficiency with Hyper-IgM | AR | 5 | 10 |
| CD40LG | Immunodeficiency, with hyper-IgM | XL | 35 | 231 |
| CD46* | Hemolytic uremic syndrome, atypical | AD/AR | 5 | 81 |
| CD55# | Blood group, Cromer system | BG | 7 | 7 |
| CD59 | CD59 deficiency | AR | 4 | 8 |
| CD70 | Primary immunodeficiency | AR | 4 | |
| CD79A | Agammaglobulinemia 3 | AR | 3 | 7 |
| CD79B | Agammaglobulinemia 6 | AR | 2 | 3 |
| CD81 | Immunodeficiency, common variable, 6 | AR | 1 | 1 |
| CD8A | CD8 deficiency | AR | 1 | 1 |
| CD93 | Complement system | AD/AR | ||
| CDAN1 | Anemia, dyserythropoietic congenital | AR | 12 | 61 |
| CDC42* | Takenouchi-Kosaki syndrome, Noonan-syndrome like phenotype | AD | 11 | 9 |
| CDCA7 | Immunodeficiency-centromeric instability-facial anomalies syndrome 3 | AR | 4 | 6 |
| CDK9 | AR | 1 | ||
| CDKN2A | Melanoma, familial, Melanoma-pancreatic cancer syndrome | AD | 87 | 232 |
| CEBPA | Acute myeloid leukemia, familial | AD | 15 | 13 |
| CEBPE | Specific granule deficiency 1 | AR | 3 | 4 |
| CECR1 | Polyarteritis nodosa, ADA2 deficiency | AR | 15 | 50 |
| CENPF | Ciliary dyskinesia -Lethal Ciliopathy | AR | 13 | 8 |
| CFB | Complement factor B deficiency, Hemolytic uremic syndrome, atypical | AD/AR | 2 | 26 |
| CFD | Complement factor D deficiency | AR | 2 | 3 |
| CFH* | Hemolytic uremic syndrome, atypical, Complement factor H deficiency, Basal laminar drusen | AD/AR | 18 | 305 |
| CFHR5 | Atypical hemolytic-uremic syndrome with anti-factor H antibodies, C3 glomerulonephritis | AD/AR | 4 | 32 |
| CFI | Hemolytic uremic syndrome, atypical, Complement factor I deficiency | AD/AR | 10 | 143 |
| CFP | Properdin deficiency | XL | 5 | 17 |
| CFTR | Cystic fibrosis, Congenital bilateral absence of the vas deferens | AD/AR | 518 | 1803 |
| CHD7 | Isolated gonadotropin-releasing hormone deficiency, CHARGE syndrome | AD | 276 | 860 |
| CHEK2#* | Breast cancer, susceptibility to | AD/AR | 275 | 197 |
| CIB1 | ||||
| CIITA | Bare lymphocyte syndrome | AR | 9 | 15 |
| CLCN7 | Osteopetrosis | AD/AR | 15 | 98 |
| CLEC7A | Candidiasis, familial, 4 | AR | ||
| CLPB | 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) | AD/AR | 26 | 25 |
| CLU | Complement system | AD/AR | 17 | |
| COG6 | Congenital disorder of glycosylation, Shaheen syndrome | AR | 10 | 9 |
| COLEC11 | 3MC syndrome | AR | 6 | 13 |
| COPA | Autoimmune interstitial lung, joint, and kidney disease | AD | 6 | 6 |
| CORO1A#* | Immunodeficiency | AR | 41 | 6 |
| CPT2 | Carnitine palmitoyltransferase II deficiency | AR | 72 | 111 |
| CR2 | Common variable immunodeficiency | AR | 2 | 16 |
| CREBBP | Rubinstein-Taybi syndrome | AD | 175 | 362 |
| CRP | Complement system | AD/AR | ||
| CSF2RA#* | Surfactant metabolism dysfunction, pulmonary | XL | 2 | 17 |
| CSF2RB | Surfactant metabolism dysfunction, pulmonary, 5 | AR | 2 | 6 |
| CSF3R | Neutrophilia, hereditary | AD/AR | 13 | 13 |
| CTC1 | Cerebroretinal microangiopathy with calcifications and cysts | AR | 21 | 33 |
| CTLA4 | Autoimmune lymphoproliferative syndrome, type V | AD | 11 | 34 |
| CTNNBL1 | ||||
| CTPS1 | Immunodeficiency 24 | AR | 1 | 1 |
| CTSC | Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome | AR | 19 | 92 |
| CXCR2 | Congenital neutropenia | AR | 1 | |
| CXCR4 | Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome | AD | 5 | 15 |
| CYBA | Chronic granulomatous disease | AR | 13 | 71 |
| CYBB | Chronic granulomatous disease, Immunodeficiency | XL | 69 | 780 |
| CYCS* | Thrombocytopenia | AD | 2 | 3 |
| CYP27A1 | Cerebrotendinous xanthomatosis | AR | 69 | 110 |
| DBR1 | Immunodeficiency | AR | 1 | |
| DCLRE1B | 1 | |||
| DCLRE1C* | Omenn syndrome, Severe combined immunodeficiency with sensitivity to ionizing radiation | AR | 18 | 89 |
| DDX11* | Warsaw breakage syndrome | AR | 7 | 7 |
| DDX41 | Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to | AD | 9 | 21 |
| DDX58 | Singleton-Merten syndrome | AD | 4 | 3 |
| DEF6 | ||||
| DGAT1 | Diarrhea | AR | 7 | 11 |
| DGKE | Nephrotic syndrome | AR | 17 | 38 |
| DHFR* | Megaloblastic anemia due to dihydrofolate reductase deficiency | AR | 2 | 5 |
| DKC1 | Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita | XL | 48 | 74 |
| DNAAF1 | Ciliary dyskinesia | AR | 19 | 38 |
| DNAAF2 | Ciliary dyskinesia | AR | 13 | 6 |
| DNAAF3 | Primary ciliary dyskinesia | AR | 11 | 5 |
| DNAAF5 | Ciliary dyskinesia | AR | 9 | 5 |
| DNAH1 | Spermatogenic failure 18, Ciliary dyskinesia, primary, 37 | AR | 15 | 32 |
| DNAH11* | Ciliary dyskinesia | AR | 66 | 130 |
| DNAH5 | Ciliary dyskinesia | AR | 140 | 197 |
| DNAH9 | Primary ciliary dyskinesia | AR | 6 | |
| DNAI1 | Ciliary dyskinesia | AR | 17 | 35 |
| DNAI2 | Ciliary dyskinesia | AR | 19 | 6 |
| DNAJC21 | Bone marrow failure syndrome 3 | AR | 5 | 11 |
| DNAL1 | Ciliary dyskinesia | AR | 3 | 1 |
| DNASE1L3 | Systemic lupus erythematosus 16 | AR | 1 | 3 |
| DNASE2 | Autoinflammatory-pancytopenia syndrome | AR | 2 | |
| DNMT3B | Immunodeficiency-centromeric instability-facial anomalies syndrome | AR | 14 | 47 |
| DOCK2 | Immunodeficiency | AR | 7 | 6 |
| DOCK8 | Hyper-IgE recurrent infection syndrome, Mental retardation, autosomal dominant 2 | AR | 54 | 168 |
| DRC1 | Ciliary dyskinesia, primary, 21 | AR | 5 | 3 |
| DTNBP1 | Hermansky-Pudlak syndrome | AR | 2 | 3 |
| DYX1C1 | Ciliary dyskinesia | AR | 15 | 12 |
| EFL1* | Shwachman-Diamond syndrome | AR | 3 | 2 |
| EIF2AK3 | SED, Wolcott-Rallison type | AR | 9 | 80 |
| ELANE | Neutropenia | AD | 43 | 217 |
| EP300 | Rubinstein-Taybi syndrome | AD | 63 | 101 |
| EPCAM | Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis | AD/AR | 38 | 80 |
| EPG5 | Vici syndrome | AR | 36 | 66 |
| EPO | 3 | 4 | ||
| ERBB2IP | 1 | 5 | ||
| ERCC2 | Xeroderma pigmentosum, Trichothiodystrophy, photosensitive, Cerebrooculofacioskeletal syndrome 2 | AR | 26 | 98 |
| ERCC3 | Xeroderma pigmentosum, Trichothiodystrophy, photosensitive | AR | 10 | 19 |
| ERCC4 | Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome | AR | 13 | 70 |
| ERCC6L2 | Bone marrow failure syndrome 2 | AR | 4 | 9 |
| ETV6 | Thrombocytopenia 5 | AD | 10 | 38 |
| EXTL3 | Immunoskeletal dysplasia with neurodevelopmental abnormalities (ISDNA) | AR | 4 | 8 |
| FAAP100 | ||||
| FAAP24 | 2 | |||
| FADD | Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations | AR | 2 | 1 |
| FANCA | Fanconi anemia | AR | 191 | 677 |
| FANCB | Fanconi anemia | XL | 11 | 21 |
| FANCC | Fanconi anemia | AR | 94 | 64 |
| FANCD2* | Fanconi anemia | AR | 21 | 61 |
| FANCE | Fanconi anemia | AR | 4 | 17 |
| FANCF | Fanconia anemia | AR | 7 | 16 |
| FANCG | Fanconi anemia | AR | 16 | 92 |
| FANCI | Fanconi anemia | AR | 13 | 45 |
| FANCL | Fanconi anemia | AR | 13 | 24 |
| FANCM | Premature ovarian failure | AR | 6 | 50 |
| FAS | Autoimmune lymphoproliferative syndrome | AD/AR | 31 | 133 |
| FASLG | Autoimmune lymphoproliferative syndrome, type IB | AD/AR | 2 | 10 |
| FAT4 | Van Maldergem syndrome 2 | AR | 13 | 33 |
| FCGR3A* | Immunodeficiency 20 | AR | 1 | |
| FCHO1 | Combined immunodeficiency | AR | ||
| FCN1 | Complement system | AD/AR | 4 | |
| FCN2 | Complement system | AD/AR | 1 | |
| FCN3 | Immunodeficiency due to Ficolin 3 deficiency | AR | 1 | |
| FERMT1 | Kindler syndrome | AR | 32 | 83 |
| FERMT3 | Leukocyte adhesion deficiency | AR | 8 | 14 |
| FLG* | Icthyosis vulgaris | AD/AR | 83 | 109 |
| FLI1 | Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet type 21 | AD | 7 | 7 |
| FLNA | Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects, Periventricular nodular heterotopia 1, Melnick-Needles syndrome, Intestinal pseudoobstruction, neuronal, X-linked/Congenital short bowel syndrome, Cardiac valvular dysplasia, X-linked | XL | 133 | 257 |
| FOXN1 | T-cell immunodeficiency, congenital alopecia, and nail dystrophy | AD/AR | 6 | 6 |
| FOXP3 | Immunodysregulation, polyendocrinopathy, and enteropathy | XL | 28 | 93 |
| FPR1 | 1 | |||
| FYB | Thrombocytopenia 3 | AR | 2 | 2 |
| G6PC3 | Neutropenia, severe congenital, Dursun syndrome | AR | 11 | 37 |
| G6PD | Glucose-6-phosphate dehydrogenase deficiency | XL | 45 | 226 |
| GAS2L2 | Primary ciliary dyskinesia | AR | 3 | |
| GAS8 | Ciliary dyskinesia, primary, 33 | AR | 4 | 6 |
| GATA1 | Anemia, without thrombocytopenia, Thrombocytopenia with beta-thalessemia,, Dyserythropoietic anemia with thrombocytopenia | XL | 21 | 15 |
| GATA2 | Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency | AD | 30 | 142 |
| GBA* | Gaucher disease | AR | 84 | 488 |
| GFI1 | Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults | AD | 2 | 6 |
| GFI1B | Bleeding disorder, platelet-type, 17 | AD | 6 | 9 |
| GINS1 | Immunodeficiency | AR | 4 | 4 |
| GLRX5 | Spasticity, childhood-onset, with hyperglycinemia | AR | 5 | 6 |
| GNE | Proximal myopathy and ophthalmoplegia, Nonaka myopathy, Sialuria | AD/AR | 78 | 214 |
| GP1BA | Pseudo-von Willebrand disease, Bernard-Soulier syndrome | AD/AR | 9 | 73 |
| GP1BB | Giant platelet disorder, isolated, Bernard-Soulier syndrome | AD/AR | 5 | 53 |
| GP9 | Bernard-Soulier syndrome | AR | 6 | 42 |
| GTF2H5 | Trichothiodystrophy 3, photosensitive | AR | 2 | 6 |
| GUCY2C | Diarrhea, Meconium ileus | AD/AR | 7 | 10 |
| HAVCR2 | AR | |||
| HAX1 | Neutropenia, severe congenital | AR | 11 | 21 |
| HELLS | Immunodeficiency-centromeric instability-facial anomalies syndrome 4 | AR | 6 | 6 |
| HMOX1 | Heme oxygenase 1 deficiency | AR | 2 | 5 |
| HNRNPK* | Au-Kline syndrome | AD | 14 | 10 |
| HOXA11 | Radioulnar synostosis with amegakaryocytic thrombocytopenia | AD | 1 | 1 |
| HPS1* | Hermansky-Pudlak syndrome | AR | 28 | 55 |
| HPS3* | Hermansky-Pudlak syndrome | AR | 10 | 17 |
| HPS4 | Hermansky-Pudlak syndrome | AR | 16 | 22 |
| HPS5 | Hermansky-Pudlak syndrome | AR | 20 | 31 |
| HPS6 | Hermansky-Pudlak syndrome | AR | 13 | 37 |
| HRAS | Costello syndrome, Congenital myopathy with excess of muscle spindles | AD | 43 | 31 |
| HSPA9 | Even-Plus syndrome | AD/AR | 5 | 13 |
| HYDIN#* | Primary ciliary dyskinesia | AR | 5 | 25 |
| HYOU1 | Combined immunodeficiency | AR | 2 | |
| ICOS | Immunodeficiency, common variable, 1 | AR | 3 | 4 |
| ICOSLG | 1 | |||
| IFIH1 | Singleton-Merten syndrome, Aicardi-Goutieres syndrome 7 | AD/AR | 14 | 19 |
| IFNAR1 | 1 | |||
| IFNAR2 | Immunodeficiency 45 | AR | 1 | 2 |
| IFNGR1 | Immunodeficiency | AD/AR | 16 | 42 |
| IFNGR2 | Immunodeficiency | AR | 4 | 18 |
| IGLL1* | Agammaglobulinemia | AR | 2 | 3 |
| IKBKB | Immunodeficiency 15 | AR | 2 | 7 |
| IKZF1 | Immunodeficiency, common variable, 13 | AD | 10 | 35 |
| IL10 | Inflammatory bowel disease | AD/AR | 1 | 5 |
| IL10RA | Inflammatory bowel disease | AR | 4 | 43 |
| IL10RB | Inflammatory bowel disease | AR | 2 | 19 |
| IL12B | Immunodeficiency 28, Immunodeficiency 29 | AR | 4 | 13 |
| IL12RB1# | Immunodeficiency | AR | 13 | 82 |
| IL12RB2 | 1 | 5 | ||
| IL17F | Candidiasis, familial, 6 | AD | 1 | 2 |
| IL17RA | Immunodeficiency 51 | AR | 8 | 17 |
| IL17RC | Candiasis, familial, 9 | AR | 3 | 4 |
| IL18BP | ||||
| IL1RN | Osteomyelitis, sterile multifocal, with periostitis and pustulosis | AR | 6 | 12 |
| IL21 | Immunodeficiency, common variable, 11 | AR | 1 | 1 |
| IL21R | Immunodeficiency, primary, autosomal recessive, IL21R-related | AD/AR | 3 | 9 |
| IL23R | Primary immunodeficiency | AR | 1 | |
| IL2RA | Interleukin 2 receptor, alpha, deficiency | AR | 6 | 6 |
| IL2RB | Autoinflammatory-pancytopenia syndrome | AR | ||
| IL2RG | Combined immunodeficiency | XL | 54 | 243 |
| IL36RN | Pustular psoriasis, generalized | AR | 6 | 26 |
| IL6R# | Autoinflammatory-pancytopenia syndrome | AR | 1 | |
| IL6ST* | Autoinflammatory-pancytopenia syndrome | AD/AR | ||
| IL7R | Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive | AR | 23 | 48 |
| INO80 | 2 | 6 | ||
| IRAK1 | 3 | 1 | ||
| IRAK4 | IRAK4 deficiency, Invasive pneumococcal disease, recurrent, isolated, 1 | AR | 12 | 29 |
| IRF2BP2 | Immunodeficiency, common variable, 14 | AD | 1 | 2 |
| IRF3 | Herpes simplex encephalitis, susceptibility to, 7 | AD | 1 | 2 |
| IRF4 | Skin/hair/eye pigmentation, variation in, 8 | AD | 1 | |
| IRF7 | Immunodeficiency 39 | AR | 2 | 2 |
| IRF8 | Immunodeficiency 32A (CD11C-positive/CD1C-positive dendritic cell deficiency), Immunodeficiency 32B (monocyte and dendritic cell deficiency) | AD/AR | 4 | 8 |
| IRF9 | 1 | |||
| ISG15 | Immunodeficiency, with basal ganglia calcification | AR | 3 | 3 |
| ITCH# | Autoimmune disease, syndromic multisystem | AR | 1 | 1 |
| ITGA2 | Fetal and neonatal alloimmune thrombocytopenia | AD/AR | 5 | |
| ITGA2B | Glanzmann thrombasthenia | AD/AR | 22 | 234 |
| ITGB2 | Leukocyte adhesion deficiency | AR | 33 | 118 |
| ITGB3 | Bleeding disorder, platelet-type 15, Thrombocytopenia, neonatal alloimmune, Glanzmann thrombasthenia | AD/AR | 18 | 165 |
| ITK | Lymphoproliferative syndrome | AR | 4 | 11 |
| JAGN1 | Neutropenia, severe congenital | AR | 8 | 8 |
| JAK1 | Primary immunodeficiency | AD/AR | 4 | 6 |
| JAK2 | Thrombocythemia 3 | AD | 12 | 22 |
| JAK3 | Severe combined immunodeficiency, T cell-negative, B cell-positive, natural killer cell-negative | AR | 30 | 66 |
| KDM1A | Cleft palate, psychomotor retardation, and distinctive facial features | AD | 5 | 17 |
| KDM6A | Kabuki syndrome | XL | 40 | 69 |
| KIF23 | Anemia, dyserythropoietic congenital | AD | 1 | 3 |
| KLF1 | Anemia, dyserythropoietic congenital, Blood group, Lutheran inhibitor, Hereditary persistence of fetal hemoglobin | AD/AR | 16 | 45 |
| KMT2A | Wiedemann-Steiner syndrome | AD | 117 | 114 |
| KMT2D | Kabuki syndrome | AD | 350 | 670 |
| KRAS* | Noonan syndrome, Cardiofaciocutaneous syndrome | AD | 63 | 35 |
| LAMTOR2 | Immunodeficiency due to defect in MAPBP-interacting protein | AR | 1 | 1 |
| LAT | Immunodeficiency 52 | AR | 2 | 18 |
| LCK | Immunodeficiency | AR | 2 | 3 |
| LCT | Lactase deficiency | AR | 11 | 15 |
| LIG1 | Autoinflammatory-pancytopenia syndrome | AR | 3 | |
| LIG4 | Severe combined immunodeficiency with sensitivity to ionizing radiation, LIG4 syndrome | AR | 18 | 36 |
| LIPA | Wolman disease, Cholesterol ester storage disease | AR | 27 | 93 |
| LPIN2 | Majeed syndrome | AR | 12 | 14 |
| LRBA | Common variable immunodeficiency | AR | 23 | 64 |
| LRRC6 | Ciliary dyskinesia | AR | 10 | 19 |
| LRRC8A | Agammaglobulinemia 5 | AD | 2 | 2 |
| LYST* | Chediak-Higashi syndrome | AR | 50 | 97 |
| LZTR1 | Schwannomatosis, Noonan syndrome | AD/AR | 34 | 71 |
| MAD2L2 | Fanconi anemia, complementation group V | 1 | 1 | |
| MAGT1 | Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95 | XL | 8 | 14 |
| MALT1 | Immunodeficiency | AR | 3 | 5 |
| MAN2B1 | Mannosidosis, alpha B, lysosomal | AR | 63 | 149 |
| MANBA | Mannosidosis, lysosomal | AR | 16 | 19 |
| MAP2K1 | Cardiofaciocutaneous syndrome | AD | 45 | 23 |
| MAP2K2 | Cardiofaciocutaneous syndrome | AD | 21 | 35 |
| MAP3K14 | Primary immunodeficiency with multifaceted aberrant lymphoid immunity | AR | 1 | 2 |
| MAP3K8 | Noonan syndrome | AD | 1 | |
| MASP1 | 3MC syndrome | AR | 11 | 22 |
| MASP2 | MASP2 deficiency | AR | 6 | |
| MASTL | Thrombocytopenia | AD | 5 | |
| MAT2A* | Complement system | AD/AR | 2 | |
| MBL2 | Mannose-binding protein deficiency | AD | 2 | 2 |
| MCIDAS | Primary ciliary dyskinesia | AR | 4 | 3 |
| MCM4 | Natural killer cell and glucocorticoid deficiency with DNA repair defect | 1 | 5 | |
| MECOM | Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 | AD | 3 | 27 |
| MEFV | Familial Mediterranean fever | AD/AR | 29 | 182 |
| MKL1 | Primary immunodeficiency | AR | 4 | |
| MLH1 | Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 873 | 1191 |
| MLPH | Griscelli syndrome, type 3 | AR | 4 | 6 |
| MOGS | Congenital disorder of glycosylation | AR | 7 | 8 |
| MPL | Thrombocythemia, Amegakaryocytic thrombocytopenia | AD/AR | 23 | 55 |
| MPO | Myeloperoxidase deficiency | AR | 12 | 14 |
| MRAS | Noonan syndrome | AD | 1 | 2 |
| MRE11A | Ataxia-telangiectasia-like disorder-1 | AR | 57 | 56 |
| MS4A1 | Immunodeficiency, common variable, 5 | AR | 1 | 2 |
| MSH2 | Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome | AD/AR | 933 | 1249 |
| MSH6 | Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 672 | 586 |
| MSN* | Immunodeficiency 50 | XL | 2 | 2 |
| MTHFD1 | Severe combined immunodeficiency | AR | 9 | 11 |
| MVK | Mevalonic aciduria, Hyper-IgD syndrome, Porokeratosis 3, multiple types | AD/AR | 35 | 181 |
| MYD88 | MYD88 deficiency | AR | 5 | 5 |
| MYH9 | Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 | AD | 25 | 117 |
| MYO5A | Griscelli syndrome | AR | 7 | 9 |
| MYO5B* | Diarrhea, with microvillus atrophy | AR | 14 | 80 |
| MYSM1 | 2 | 3 | ||
| NAF1 | AD | 2 | ||
| NBAS | Infantile liver failure syndrome 2, Short stature, optic nerve atrophy, and Pelger-Huet anomaly (SOPH syndrome) | AR | 23 | 43 |
| NBEAL2 | Gray platelet syndrome | AR | 10 | 51 |
| NBN | Breast cancer, Nijmegen breakage syndrome | AR | 188 | 97 |
| NCF1#* | Chronic granulomatous disease | AR | 18 | 44 |
| NCF2 | Chronic granulomatous disease | AR | 19 | 72 |
| NCF4 | Granulomatous disease | AR | 4 | 5 |
| NCKAP1L | ||||
| NCSTN | Acne inversa, familial 1 | AD | 7 | 30 |
| NEUROG3 | Diarrhea, malabsorptive, congenital | AR | 3 | 8 |
| NF1* | Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome | AD | 1157 | 2901 |
| NFAT5 | 3 | |||
| NFE2L2 | 11 | 6 | ||
| NFIL3 | 1 | |||
| NFKB1 | Common variable immunodeficiency | AD | 8 | 17 |
| NFKB2 | Common variable immunodeficiency | AD | 6 | 11 |
| NFKBIA | Ectodermal dysplasia, anhidrotic, with T-cell immunodeficiency | AD | 5 | 11 |
| NHEJ1 | Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation | AR | 15 | 16 |
| NHP2 | Dyskeratosis congenita | AR | 5 | 3 |
| NLRC4 | Autoinflammation with infantile enterocolitis (AIFEC), Familial cold autoinflammatory syndrome 4 | AD | 6 | 8 |
| NLRP1 | Palmoplantar carcinoma, multiple self-healing, Autoinflammation with arthritis and dyskeratosis | AD/AR | 5 | 15 |
| NLRP12 | Familial cold autoinflammatory syndrome | AD | 12 | 12 |
| NLRP3 | Neonatal onset multisystem inflammatory disease (NOMID), Muckle-Wells syndrome, Chronic infantile neurologic cutaneous articular (CINCA) syndrome, Familial cold-induced autoinflammatory syndrome 1, Deafness | AD | 20 | 136 |
| NME8 | Ciliary dyskinesia | AR | 1 | 6 |
| NOD2 | Blau syndrome, Sarcoidosis, early-onset | AD | 12 | 70 |
| NOP10 | Dyskeratosis congenita | AR | 1 | 1 |
| NRAS | Noonan syndrome | AD | 31 | 14 |
| NSMCE2 | Seckel syndrome 10 | 3 | 2 | |
| NSMCE3 | Lung disease, immunodeficiency, and chromosome breakage syndrome (LICS) | AR | 2 | 2 |
| NUP214 | AR | 1 | 4 | |
| OAS1 | ||||
| OBFC1 | 2 | 2 | ||
| OFD1 | Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, Orofaciodigital syndrome, Joubert syndrome | XL | 153 | 160 |
| ORAI1 | Immunodeficiency, Myopathy, tubular aggregate, 2 | AD/AR | 9 | 13 |
| OSTM1 | Osteopetrosis, autosomal recessive 5 | AR | 5 | 9 |
| OTUD6B | Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies (IDDFSDA) | AR | 6 | 4 |
| OTULIN | Autoinflammation, panniculitis, and dermatosis syndrome (AIPDS) | AR | 8 | 3 |
| PALB2 | Fanconi anemia, Pancreatic cancer, Breast cancer | AD/AR | 495 | 406 |
| PARN* | Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita | AD/AR | 15 | 29 |
| PAX5 | Pre-B cell acute lymphoblastic leukemia | AD | 7 | |
| PEPD | Prolidase deficiency | AR | 12 | 31 |
| PGM3# | Immunodeficiency 23 | AR | 14 | 15 |
| PIGA* | Multiple congenital anomalies-hypotonia-seizures syndrome | XL | 24 | 27 |
| PIH1D3 | Ciliary dyskinesia, primary, 36 | XL | 2 | 12 |
| PIK3CD* | Immunodeficiency | AD | 6 | 12 |
| PIK3R1 | Agammaglobulinemia, SHORT syndrome | AD/AR | 33 | 24 |
| PLCG2 | Familial cold autoinflammatory syndrome 3 (PLAID), Autoinflammation, antibody deficiency, and immune dysregulation syndrome (APLAID) | AD | 7 | 13 |
| PLEKHM1* | Osteopetrosis, autosomal recessive 6, Osteopetrosis | AD/AR | 3 | 4 |
| PLG* | Plasminogen deficiency, type I, Angioedema | AD/AR | 10 | 74 |
| PMM2 | Congenital disorder of glycosylation | AR | 76 | 128 |
| PMS2#* | Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 319 | 342 |
| PNP | Purine nucleoside phosphorylase deficiency | AR | 11 | 33 |
| POLA1 | Pigmentary disorder, reticulate, with systemic manifestations, X-linked, Neurodevelopmental disorder | 2 | 1 | |
| POLD1 | Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency | AD/AR | 3 | 31 |
| POLD2 | ||||
| POLE | Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) | AD/AR | 8 | 70 |
| POLE2 | Combined immunodeficiency | AR | 3 | |
| POLR3A | Leukodystrophy, hypomyelinating | AR | 29 | 91 |
| POLR3C | 1 | |||
| POLR3F | ||||
| POMP | Keratosis linearis with ichthyosis congenita and sclerosing keratoderma | AR | 5 | 4 |
| POT1 | Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 | AD | 2 | 34 |
| PPP1CB | Noonan syndrome-like disorder with loose anagen hair 2 | AD | 8 | 11 |
| PRF1 | Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis | AR | 24 | 183 |
| PRG4 | Camptodactyly-arthropathy-coxa vara-pericarditis syndrome | AR | 6 | 35 |
| PRKACG | Bleeding disorder, platelet-type, 19 | AR | 1 | 1 |
| PRKCD | Autoimmune lymphoproliferative syndrome type III | AR | 4 | 6 |
| PRKDC | Immunodeficiency | AR | 6 | 9 |
| PSEN1 | Dementia, frontotemporal, Pick disease, Alzheimer disease | AD | 57 | 306 |
| PSENEN | Acne inversa, familial, 2 | AD | 7 | 17 |
| PSMB8 | Nakajo-Nishimura syndrome, Chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature syndrome, Autoinflammation, lipodystrophy, and dermatosis syndrome, Joint contractures, muscular atrophy, microcytic anemia, and panniculitis-induced lipodystrophy syndrome | AR | 5 | 9 |
| PSMG2 | ||||
| PSTPIP1 | Pyogenic sterile arthritis, pyoderma gangrenosum, and acne | AD | 5 | 29 |
| PTEN* | Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome | AD | 435 | 638 |
| PTPN11 | Noonan syndrome, Metachondromatosis | AD | 135 | 140 |
| PTPRC | Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive | AR | 4 | 5 |
| PTRF | Lipodystrophy, congenital generalized | AR | 9 | 15 |
| PTX3 | Complement system | AD/AR | 1 | |
| PUS1 | Mitochondrial myopathy and sideroblastic anemia | AR | 7 | 9 |
| RAB27A | Griscelli syndrome, Elejalde syndrome | AR | 18 | 54 |
| RAC2 | Neutrophil immunodeficiency syndrome | AD/AR | 2 | 3 |
| RAD50 | Nijmegen breakage syndrome-like disorder | AR | 183 | 88 |
| RAD51# | Mirror movements 2, Fanconi anemia, complementation group R | AD | 7 | 10 |
| RAD51C | Fanconi anemia, Breast-ovarian cancer, familial | AD/AR | 107 | 125 |
| RAF1 | LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) | AD | 45 | 53 |
| RAG1 | Omenn syndrome, Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity, T cell-negative, B cell-negative, natural killer cell-positive severe combined immunodeficiency, Combined cellular and humoral immune defects with granulomas | AR | 47 | 184 |
| RAG2 | Omenn syndrome, Combined cellular and humoral immune defects with granulomas | AR | 28 | 79 |
| RANBP2* | Encephalopathy, acute, infection-induced, 3, susceptibility to | AD | 41 | 6 |
| RAP1A | 1 | |||
| RAP1B | 1 | |||
| RASA2 | Noonan syndrome | AD | 1 | 3 |
| RASGRP1 | Primary immunodeficiency | AR | 1 | 3 |
| RBCK1 | Polyglucosan body myopathy | AR | 11 | 14 |
| RBM8A* | Thrombocytopenia - absent radius | AR | 5 | 12 |
| RECQL4 | Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome | AR | 82 | 114 |
| REL# | AD/AR | |||
| RELA* | Autoimmune lymphoproliferative syndrome, Autoinflammatory syndrome, familial, Behcet-like | AD | 1 | 3 |
| RELB | Immunodeficiency 53 | 1 | 1 | |
| RFWD3 | 2 | 2 | ||
| RFX5 | Bare lymphocyte syndrome | AR | 4 | 10 |
| RFXANK | MHC class II deficiency | AR | 8 | 16 |
| RFXAP | Bare lymphocyte syndrome | AR | 6 | 9 |
| RHOH | T-cell immunodeficiency with epidermodysplasia verruciformis | AD/AR | 1 | |
| RIPK1 | Autoinflammatory-pancytopenia syndrome | AD/AR | 3 | 1 |
| RIT1 | Noonan syndrome | AD | 23 | 26 |
| RLTPR | Combined immunodeficiency | AR | 11 | 8 |
| RMRP | Cartilage-hair hypoplasia, Metaphyseal dysplasia without hypotrichosis, Anauxetic dysplasia | AR | 87 | 123 |
| RNASEH2A | Aicardi-Goutières syndrome | AR | 13 | 21 |
| RNASEH2B | Aicardi-Goutières syndrome | AR | 16 | 41 |
| RNASEH2C | Aicardi-Goutières syndrome | AR | 6 | 14 |
| RNF168 | RIDDLE syndrome | AR | 4 | 5 |
| RNF31 | HOIP and LUBAC deficiency | AR | 1 | |
| RNU4ATAC | Roifman syndrome, Microcephalic osteodysplastic primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3 | AR | 15 | 24 |
| RORC | Immunodeficiency 42 | AR | 3 | 3 |
| RPGR | Retinitis pigmentosa, Cone-rod dystrophy, X-linked, 1, Macular degeneration, X-linked atrophic, Retinitis pigmentosa 3 | XL | 79 | 218 |
| RPL10 | Autism | XL | 4 | 5 |
| RPL11 | Diamond-Blackfan anemia | AD | 12 | 45 |
| RPL15#* | Diamond-Blackfan anemia | AD | 2 | 2 |
| RPL18 | ||||
| RPL19 | 1 | |||
| RPL26 | Diamond-Blackfan anemia 11 | AD | 2 | 1 |
| RPL27 | Diamond-Blackfan anemia 16 | 1 | 1 | |
| RPL35A | Diamond-Blackfan anemia | AD | 7 | 14 |
| RPL36 | 1 | |||
| RPL5 | Diamond-Blackfan anemia | AD | 19 | 77 |
| RPL9 | 2 | |||
| RPS10 | Diamond-Blackfan anemia | AD | 3 | 5 |
| RPS14 | ||||
| RPS15 | 1 | |||
| RPS15A | 1 | |||
| RPS19 | Diamond-Blackfan anemia | AD | 23 | 172 |
| RPS24 | Diamond-Blackfan anemia | AD | 6 | 10 |
| RPS26 | Diamond-Blackfan anemia | AD | 10 | 33 |
| RPS27 | Diamond-Blackfan anemia 17 | 1 | 1 | |
| RPS27A | 1 | |||
| RPS28 | Diamond-Blackfan anemia 15 with mandibulofacial dysostosis | AD | 1 | 1 |
| RPS29 | Diamond-Blackfan anemia | AD | 4 | 4 |
| RPS7 | Diamond-Blackfan anemia | AD | 2 | 10 |
| RPSA | Asplenia, isolated congenital | AD | 7 | 8 |
| RRAS | Noonan-syndrome like phenotype | AD/AR | 2 | |
| RSPH1 | Ciliary dyskinesia | AR | 14 | 10 |
| RSPH3 | Ciliary dyskinesia, primary, 32 | AR | 7 | 5 |
| RSPH4A | Ciliary dyskinesia | AR | 18 | 24 |
| RSPH9 | Ciliary dyskinesia | AR | 8 | 12 |
| RTEL1 | Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita | AD/AR | 58 | 51 |
| RUNX1 | Platelet disorder, familial, with associated myeloid malignancy | AD | 47 | 101 |
| SAMD9 | Mirage syndrome, Tumoral calcinosis, normophosphatemic | AD/AR | 10 | 27 |
| SAMD9L | Ataxia-pancytopenia syndrome | AD | 4 | 16 |
| SAMHD1 | Aicardi-Goutières syndrome, Chilblain lupus 2 | AD/AR | 25 | 56 |
| SAR1B | Chylomicron retention disease (Anderson disease) | AR | 8 | 16 |
| SBDS* | Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia | AR | 19 | 90 |
| SBF2 | Charcot-Marie-Tooth disease | AR | 25 | 21 |
| SEC23B | Anemia, dyserythropoietic congenital | AR | 18 | 121 |
| SEC61A1 | Hyperuricemic nephropathy, familial juvenile 4 | AD | 4 | 4 |
| SEMA3E | CHARGE syndrome | AD | 1 | 4 |
| SERPING1 | Angioedema, Complement component 4, partial deficiency of | AD/AR | 34 | 563 |
| SH2D1A | Lymphoproliferative syndrome | XL | 21 | 129 |
| SH3BP2 | Cherubism | AD | 9 | 16 |
| SH3KBP1 | 2 | 1 | ||
| SHOC2 | Noonan-like syndrome with loose anagen hair | AD | 2 | 4 |
| SI | Sucrase-isomaltase deficiency, congenital | AR | 12 | 23 |
| SKIV2L | Trichohepatoenteric syndrome 2 | AR | 6 | 33 |
| SLC10A2 | Bile acid malabsorption, primary | AD/AR | 2 | 4 |
| SLC19A2 | Thiamine-responsive megaloblastic anemia syndrome | AR | 14 | 51 |
| SLC25A38 | Anemia, sideroblastic 2, pyridoxine-refractory | AR | 7 | 27 |
| SLC26A3 | Diarrhea, secretory chloride, congenital | AR | 55 | 88 |
| SLC29A3 | Histiocytosis-lymphadenopathy plus syndrome, Dysosteosclerosis | AR | 17 | 25 |
| SLC35A1 | Congenital disorder of glycosylation | AR | 4 | 5 |
| SLC35C1 | Congenital disorder of glycosylation, Leukocyte adhesion deficiency | AR | 6 | 7 |
| SLC37A4 | Glycogen storage disease | AD/AR | 49 | 113 |
| SLC39A4 | Acrodermatitis enteropathica | AR | 13 | 50 |
| SLC39A7 | Agammaglobulinemia | AR | ||
| SLC46A1 | Folate malabsorption | AR | 17 | 23 |
| SLC5A1 | Glucose/galactose malabsorption | AR | 3 | 58 |
| SLC7A7 | Lysinuric protein intolerance | AR | 55 | 67 |
| SLC9A3 | Diarrhea, secretory sodium, congenital | AR | 6 | 12 |
| SLFN14 | Thrombocytopenia | AD | 4 | 4 |
| SLX4 | Fanconi anemia | AR | 18 | 72 |
| SMARCAL1 | Schimke immunoosseous dysplasia | AR | 20 | 88 |
| SMARCD2 | Specific granule defiency 2 | AR | 3 | 1 |
| SNX10 | Osteopetrosis, autosomal recessive 8 | AR | 3 | 13 |
| SOS1 | Noonan syndrome | AD | 44 | 71 |
| SOS2 | Noonan syndrome 9 | AD | 4 | 6 |
| SP110 | Hepatic venoocclusive disease with immunodeficiency | AR | 8 | 8 |
| SPAG1 | Primary ciliary dyskinesia | AR | 18 | 11 |
| SPINK5 | Netherton syndrome | AR | 29 | 85 |
| SPINT2 | Diarrhea, secretory sodium, congenital | AR | 6 | 12 |
| SPPL2A | Autoinflammatory-pancytopenia syndrome | AR | 1 | |
| SPRED1 | Legius syndrome | AD | 38 | 71 |
| SRC | Thrombocytopenia, autosomal dominant, 6 | AD | 2 | 1 |
| SRP54 | Shwachman-Diamond syndrome | AD | 3 | |
| SRP72* | Bone marrow failure syndrome 1 | AD | 2 | 5 |
| STAT1 | Immunodeficiency | AD/AR | 39 | 122 |
| STAT2 | Immunodeficiency | AR | 3 | 6 |
| STAT3 | Hyper-IgE recurrent infection syndrome, Autoimmune disease, multisystem, infantile onset | AD | 47 | 152 |
| STAT5B* | Growth hormone insensitivity with immunodeficiency | AD/AR | 9 | 13 |
| STIM1 | Stormorken syndrome, Immunodeficiency, Myopathy, tubular aggregate 1 | AD/AR | 13 | 24 |
| STK36 | Primary ciliary dyskinesia | AR | 5 | |
| STK4 | T-cell immunodeficiency syndrome, recurrent infections, autoimmunity, | AR | 3 | 7 |
| STX11 | Hemophagocytic lymphohistiocytosis, familial | AR | 8 | 22 |
| STX3 | Microvillus inclusion disease | AR | 3 | |
| STXBP2 | Hemophagocytic lymphohistiocytosis, familial | AR | 12 | 77 |
| STXBP3 | 1 | |||
| TAP1 | Bare lymphocyte syndrome | AR | 1 | 7 |
| TAP2 | Bare lymphocyte syndrome | AR | 4 | 8 |
| TAPBP | Bare lymphocyte syndrome | AR | 1 | 2 |
| TASP1 | 1 | 1 | ||
| TAZ | 3-Methylglutaconic aciduria, (Barth syndrome) | XL | 45 | 158 |
| TBK1 | Herpes simplex encephalitis, Frontotemporal dementia and/or amyotrophic lateral sclerosis 4 | AD | 11 | 133 |
| TBX1 | Conotruncal anomaly face syndrome | AD | 17 | 72 |
| TCF3 | Agammaglobulinemia 8, autosomal dominant | AD | 1 | 5 |
| TCIRG1 | Osteopetrosis, severe neonatal or infantile forms (OPTB1) | AD/AR | 48 | 130 |
| TCN2 | Transcobalamin II deficiency | AR | 9 | 35 |
| TERC | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD | 42 | 73 |
| TERF2 | 2 | |||
| TERF2IP | 6 | |||
| TERT | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD/AR | 48 | 156 |
| TFRC | Immunodeficiency 46 | AR | 8 | 2 |
| TGFB1 | Diaphyseal dysplasia Camurati-Engelmann, Inflammatory bowel disease | AD/AR | 15 | 23 |
| TGFBR1 | Loeys-Dietz syndrome | AD | 40 | 69 |
| TGFBR2 | Loeys-Dietz syndrome | AD | 58 | 139 |
| THBD | Thrombophilia due to thrombomodulin defect, Hemolytic uremic syndrome, atypical | AD | 5 | 28 |
| THPO | Thrombocythemia 1 | AD/AR | 5 | 10 |
| THRA | Hypothyroidism, congenital, nongoitrous, 6 | AD | 8 | 13 |
| THRB | Thyroid hormone resistance | AD/AR | 61 | 165 |
| TICAM1 | Herpes simplex encephalitis, susceptibility to, 4 | AD/AR | 4 | |
| TINF2 | Revesz syndrome, Dyskeratosis congenita | AD | 25 | 42 |
| TIRAP | AD/AR | 1 | ||
| TLR3 | Herpes simplex encephalitis, susceptibility to, 2 | AD/AR | 14 | |
| TMC6 | Epidermodysplasia verruciformis | AR | 8 | 7 |
| TMC8 | Epidermodysplasia verruciformis | AR | 3 | 9 |
| TMEM173 | STING-associated vasculopathy, infantile-onsent (SAVI) | AD/AR | 4 | 10 |
| TNFAIP3 | Autoinflammatory syndrome, familial, Behcet-like | AD | 8 | 23 |
| TNFRSF11A | Familial expansile osteolysis, Paget disease of bone, Osteopetrosis, severe neonatal or infantile forms (OPTB1) | AD/AR | 8 | 24 |
| TNFRSF13B | Common variable immunodeficiency, Immunoglobulin A deficiency | AD/AR | 7 | 48 |
| TNFRSF13C | Immunodeficiency, common variable 4 | AR | 1 | 3 |
| TNFRSF1A# | Periodic fever (TNF receptor-associated periodic syndrome) | AD | 19 | 106 |
| TNFRSF4 | Immunodeficiency | AR | 1 | 1 |
| TNFRSF9 | Immunodeficiency | AR | ||
| TNFSF11 | Osteopetrosis, autosomal recessive 2 | AR | 3 | 5 |
| TNFSF12 | 1 | |||
| TOP2B | AD | 1 | 1 | |
| TP53 | Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma | AD | 393 | 505 |
| TPP2 | 1 | 1 | ||
| TRAC | T-cell receptor-alpha/beta deficiency | AR | 1 | 1 |
| TRADD | 3 | |||
| TRAF3 | Herpes simplex encephalitis, susceptibility to, 3 | AD | 1 | 1 |
| TRAF3IP2 | Candidiasis, familial 8 | AR | 1 | 3 |
| TREX1 | Vasculopathy, retinal, with cerebral leukodystrophy, Chilblain lupus, Aicardi-Goutières syndrome | AD/AR | 30 | 71 |
| TRIM22 | 4 | |||
| TRNT1 | Retinitis pigmentosa and erythrocytic microcytosis, Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay | AR | 13 | 26 |
| TSR2 | Diamond-Blackfan anemia 14 with mandibulofacial dysostosis | XL | 3 | 2 |
| TTC37 | Trichohepatoenteric syndrome, Autoinflammatory-pancytopenia syndrome | AR | 12 | 64 |
| TTC7A | Gastrointestinal defects and immunodeficiency syndrome | AR | 21 | 46 |
| TUBB1 | Macrothrombocytopenia | AD | 2 | 7 |
| TYK2 | Immunodeficiency | AR | 9 | 9 |
| UBE2T | Fanconi anemia, complementation group T | AR | 2 | 7 |
| UNC119 | Immunodeficiency, Cone-rod dystrophy 2 | AD | 1 | 5 |
| UNC13D | Hemophagocytic lymphohistiocytosis, familial | AR | 22 | 192 |
| UNC93B1* | Herpes simplex encephalitis, susceptibility to, 1 | AR | 2 | |
| UNG | Immunodeficiency with hyper-IgM, type 5 | AR | 6 | 7 |
| USB1 | Poikiloderma with neutropenia | AR | 24 | 22 |
| USP18#* | Pseudo-TORCH syndrome 2 | AR | 40 | 1 |
| VPS13B | Cohen syndrome | AR | 351 | 203 |
| VPS45# | Neutropenia, severe congenital, 5, autosomal recessive | AR | 3 | 4 |
| VSIG4 | Complement system | XL | 2 | |
| VTN | Complement system | AD/AR | ||
| WAS | Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome | XL | 57 | 439 |
| WDR1 | AR | 8 | ||
| WIPF1 | Wiskott-Aldrich syndrome 2 | AR | 2 | 3 |
| WRAP53 | Dyskeratosis congenita | AR | 7 | 6 |
| XIAP* | Lymphoproliferative syndrome | XL | 14 | 96 |
| XRCC2 | Hereditary breast cancer | AD/AR | 10 | 21 |
| ZAP70 | Selective T-cell defect | AR | 15 | 29 |
| ZBTB24 | Immunodeficiency-Centromeric Instability-Facial Anomalies 2 | AR | 7 | 17 |
| ZCCHC8 | 1 | |||
| ZMYND10 | Ciliary dyskinesia | AR | 8 | 16 |
| ZNF341* | AR | 5 |
The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
Some, or all, of the gene is duplicated in the genome. Read more.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Comprehensive Immune and Cytopenia Panel
To view complete table content, scroll horizontally.
| Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
|---|---|---|---|---|
| ADA | Chr20:43248503 | c.1079-15T>A | NM_000022.2 | rs387906268 |
| ADA | Chr20:43249076 | c.976-34G>A | NM_000022.2 | |
| ALAS2 | ChrX:55054634 | c.-15-2186C>G | NM_000032.4 | |
| ALAS2 | ChrX:55054635 | c.-15-2187T>C | NM_000032.4 | |
| ALAS2 | ChrX:55054636 | c.-15-2188A>G | NM_000032.4 | |
| ALAS2 | ChrX:55057393 | c.-34C>T | NM_000032.4 | rs780642606 |
| ALAS2 | ChrX:55057617 | c.-258C>G | NM_000032.4 | rs140772352 |
| ANKRD26 | Chr10:27389371 | c.-116C>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389373 | c.-118C>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389374 | c.-119C>A/G | NM_014915.2 | |
| ANKRD26 | Chr10:27389376 | c.-121A>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389380 | c.-127_-126delAT | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389389 | c.-134G>A | NM_014915.2 | rs863223318 |
| ATM | Chr11:108093770 | c.-174A>G | NM_000051.3 | |
| ATM | Chr11:108094508 | c.-31+595G>A | NM_000051.3 | |
| ATM | Chr11:108098321 | c.-30-1G>T | NM_000051.3 | rs869312754 |
| ATM | Chr11:108138753 | c.2639-384A>G | NM_000051.3 | |
| ATM | Chr11:108141209 | c.2839-579_2839-576delAAGT | NM_000051.3 | |
| ATM | Chr11:108151710 | c.3403-12T>A | NM_000051.3 | rs201370733 |
| ATM | Chr11:108158168 | c.3994-159A>G | NM_000051.3 | rs864622543 |
| ATM | Chr11:108164028 | c.4612-12A>G | NM_000051.3 | |
| ATM | Chr11:108179837 | c.5763-1050A>G | NM_000051.3 | rs774925473 |
| ATM | Chr11:108214779 | c.8418+681A>G | NM_000051.3 | rs748635985 |
| BRCA1 | Chr17:41196352 | c.*1340_*1342delTGT | NM_007294.3 | rs1281551853 |
| BRCA1 | Chr17:41196424 | c.*1271T>C | NM_007294.3 | |
| BRCA1 | Chr17:41197167 | c.*528G>C | NM_007294.3 | rs1060504556 |
| BRCA1 | Chr17:41197588 | c.*103_*106delTGTC | NM_007294.3 | rs431825382 |
| BRCA1 | Chr17:41197637 | c.*58C>T | NM_007294.3 | rs137892861 |
| BRCA1 | Chr17:41197859 | c.5468-40T>A | NM_007294.3 | rs80358151 |
| BRCA1 | Chr17:41199745 | c.5407-25T>A | NM_007294.3 | rs758780152 |
| BRCA1 | Chr17:41201232 | c.5333-36_5333-22delTACTGCAGTGATTTT | NM_007294.3 | |
| BRCA1 | Chr17:41206122 | c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG | NM_007294.3 | |
| BRCA1 | Chr17:41209164 | c.5194-12G>A | NM_007294.3 | rs80358079 |
| BRCA1 | Chr17:41215994 | c.5075-27delA | NM_007294.3 | |
| BRCA1 | Chr17:41251909 | c.442-22_442-13delTGTTCTTTAC | NM_007294.3 | rs879254224 |
| BRCA1 | Chr17:41256984 | c.213-11T>G | NM_007294.3 | rs80358061 |
| BRCA1 | Chr17:41256985 | c.213-12A>G | NM_007294.3 | rs80358163 |
| BRCA1 | Chr17:41256988 | c.213-15A>G | NM_007294.3 | |
| BRCA1 | Chr17:41276134 | c.-19-2A>G | NM_007294.3 | |
| BRCA2 | Chr13:32889805 | c.-40+1G>A | NM_000059.3 | |
| BRCA2 | Chr13:32890469 | c.-39-89delC | NM_000059.3 | |
| BRCA2 | Chr13:32890556 | c.-39-1_-39delGA | NM_000059.3 | rs758732038 |
| BRCA2 | Chr13:32890558 | c.-39-1G>A | NM_000059.3 | rs1060499566 |
| BRCA2 | Chr13:32900222 | c.426-12_426-8delGTTTT | NM_000059.3 | rs276174844 |
| BRCA2 | Chr13:32945079 | c.8488-14A>G | NM_000059.3 | |
| BRCA2 | Chr13:32953872 | c.8954-15T>G | NM_000059.3 | |
| BRCA2 | Chr13:32971007 | c.9502-28A>G | NM_000059.3 | rs397508059 |
| BRCA2 | Chr13:32971023 | c.9502-12T>G | NM_000059.3 | rs81002803 |
| BRIP1 | Chr17:59858864 | c.1629-498A>T | NM_032043.2 | |
| BTK | ChrX:100609705 | c.1567-23A>G | NM_000061.2 | |
| BTK | ChrX:100609705 | c.1567-23A>C | NM_000061.2 | |
| BTK | ChrX:100612468 | c.1177+28_1177+29insAGAAAAAAGGT | NM_000061.2 | |
| BTK | ChrX:100613695 | c.895-11C>A | NM_000061.2 | |
| BTK | ChrX:100625094 | c.310-28_310-27delGCinsTG | NM_000061.2 | |
| BTK | ChrX:100629415 | c.240+109C>A | NM_000061.2 | |
| BTK | ChrX:100629416 | c.240+108T>G | NM_000061.2 | |
| BTK | ChrX:100629827 | c.142-205A>G | NM_000061.2 | |
| BTK | ChrX:100630121 | c.141+11C>T | NM_000061.2 | rs138411530 |
| BTK | ChrX:100641044 | c.-31+6T>G | NM_000061.2 | |
| BTK | ChrX:100641045 | c.-31+5G>A | NM_000061.2 | |
| BTK | ChrX:100641045 | c.-31+5G>T | NM_000061.2 | rs1131691354 |
| BTK | ChrX:100641045 | c.-31+5G>C | NM_000061.2 | |
| BTK | ChrX:100641049 | c.-31+1G>A | NM_000061.2 | |
| BTK | ChrX:100641049 | c.-31+1G>C | NM_000061.2 | |
| BTK | ChrX:100641050 | c.-31G>A | NM_000061.2 | |
| BTK | ChrX:100641212 | c.-193A>G | NM_000061.2 | |
| C1QB | Chr1:22985931 | c.-17-2A>C | NM_000491.3 | |
| C7 | Chr5:40931143 | c.63-23T>A | NM_000587.2 | rs772462732 |
| CCDC39 | Chr3:180365042 | c.1363-11A>G | NM_181426.1 | |
| CCDC39 | Chr3:180367928 | c.1167+1261A>G | NM_181426.1 | rs577069249 |
| CCDC39 | Chr3:180367941 | c.1167+1248A>G | NM_181426.1 | |
| CD40LG | ChrX:135736498 | c.289-32_289-25delAAAATGAC | NM_000074.2 | |
| CD40LG | ChrX:135736517 | c.289-15T>A | NM_000074.2 | |
| CD40LG | ChrX:135737600 | c.347-915A>T | NM_000074.2 | |
| CD46 | Chr1:207930564 | c.286+27delT | NM_002389.4 | rs771669828 |
| CDKN2A | Chr9:21968346 | c.458-105A>G | NM_000077.4 | |
| CDKN2A | Chr9:21973573 | c.150+1104C>A | NM_000077.4 | rs756102261 |
| CDKN2A | Chr9:21974401 | c.*73+2T>G | NM_058197.4 | |
| CDKN2A | Chr9:21974847 | c.-21C>T | NM_000077.4 | |
| CDKN2A | Chr9:21974875 | c.-49C>A | NM_000077.4 | rs1064797383 |
| CDKN2A | Chr9:21974882 | c.-56G>T | NM_000077.4 | |
| CDKN2A | Chr9:21974916 | c.-93_-91delAGG | NM_000077.4 | |
| CECR1 | Chr22:17664763 | c.1082-1113delA | NM_017424.2 | |
| CFTR | Chr7:117119654 | c.-495C>T | NM_000492.3 | rs397507565 |
| CFTR | Chr7:117119797 | NM_000492.3 | ||
| CFTR | Chr7:117119900 | c.-249G>C | NM_000492.3 | |
| CFTR | Chr7:117119984 | c.-165G>A | NM_000492.3 | rs145483167 |
| CFTR | Chr7:117120064 | c.-85C>G | NM_000492.3 | |
| CFTR | Chr7:117120115 | c.-34C>T | NM_000492.3 | rs756314710 |
| CFTR | Chr7:117120325 | c.53+124T>C | NM_000492.3 | |
| CFTR | Chr7:117179040 | c.870-1113_870-1110delGAAT | NM_000492.3 | rs397508809 |
| CFTR | Chr7:117182041 | c.1117-26_1117-25delAT | NM_000492.3 | rs397508159 |
| CFTR | Chr7:117199500 | c.1393-18G>A | NM_000492.3 | rs397508199 |
| CFTR | Chr7:117227774 | c.1585-19T>C | NM_000492.3 | rs778457306 |
| CFTR | Chr7:117227921 | c.1679+34G>T | NM_000492.3 | rs767901668 |
| CFTR | Chr7:117229521 | c.1680-886A>G | NM_000492.3 | rs397508266 |
| CFTR | Chr7:117229524 | c.1680-883A>G | NM_000492.3 | |
| CFTR | Chr7:117229530 | c.1680-877G>T | NM_000492.3 | rs397508261 |
| CFTR | Chr7:117243855 | c.2908+19G>C | NM_000492.3 | rs370683572 |
| CFTR | Chr7:117246713 | c.2909-15T>G | NM_000492.3 | rs397508455 |
| CFTR | Chr7:117246840 | c.2988+33G>T | NM_000492.3 | |
| CFTR | Chr7:117251609 | c.3140-26A>G | NM_000492.3 | rs76151804 |
| CFTR | Chr7:117251619 | c.3140-16T>A | NM_000492.3 | rs767232138 |
| CFTR | Chr7:117251624 | c.3140-11A>G | NM_000492.3 | |
| CFTR | Chr7:117266272 | c.3469-1304C>G | NM_000492.3 | |
| CFTR | Chr7:117267864 | c.3717+40A>G | NM_000492.3 | rs397508595 |
| CFTR | Chr7:117280015 | c.3718-2477C>T | NM_000492.3 | rs75039782 |
| CFTR | Chr7:117282680 | c.3873+33A>G | NM_000492.3 | rs397508622 |
| CFTR | Chr7:117288374 | c.3874-4522A>G | NM_000492.3 | |
| CHD7 | Chr8:61734568 | c.2836-15C>G | NM_017780.3 | |
| CHD7 | Chr8:61757794 | c.5051-15T>A | NM_017780.3 | |
| CHD7 | Chr8:61763034 | c.5405-18C>A | NM_017780.3 | rs199981784 |
| CHD7 | Chr8:61763035 | c.5405-17G>A | NM_017780.3 | rs794727423 |
| CHD7 | Chr8:61763039 | c.5405-13G>A | NM_017780.3 | rs1131690787 |
| CLCN7 | Chr16:1506057 | c.916+57A>T | NM_001287.5 | |
| CLCN7 | Chr16:1507356 | c.739-18G>A | NM_001287.5 | rs371893553 |
| COG6 | Chr13:40273614 | c.1167-24A>G | NM_020751.2 | rs730882236 |
| CREBBP | Chr16:3788684 | c.4281-11C>G | NM_004380.2 | rs587783493 |
| CTSC | Chr11:88070895 | c.-55C>A | NM_001814.4 | rs766114323 |
| CYBA | Chr16:88712620 | c.288-15C>G | NM_000101.3 | |
| CYBB | ChrX:37639262 | c.-69A>C | NM_000397.3 | |
| CYBB | ChrX:37639262 | NM_000397.3 | ||
| CYBB | ChrX:37639264 | c.-67T>C | NM_000397.3 | |
| CYBB | ChrX:37639266 | c.-65C>T | NM_000397.3 | |
| CYBB | ChrX:37639267 | c.-64C>T | NM_000397.3 | |
| CYBB | ChrX:37641327 | c.46-14_46-11delTTCTinsGAA | NM_000397.3 | |
| CYBB | ChrX:37641330 | c.46-11T>G | NM_000397.3 | |
| CYBB | ChrX:37642713 | c.142-28_142-12delACTCTGCTCCCTTTCCC | NM_000397.3 | |
| CYBB | ChrX:37642731 | c.142-12delCinsACCTCTTCTAG | NM_000397.3 | |
| CYBB | ChrX:37654041 | c.483+978G>T | NM_000397.3 | |
| CYBB | ChrX:37656474 | c.674+1080A>G | NM_000397.3 | |
| CYBB | ChrX:37656731 | c.674+1337T>G | NM_000397.3 | |
| CYBB | ChrX:37657051 | c.675-1157A>G | NM_000397.3 | |
| CYBB | ChrX:37664248 | c.1152-11T>G | NM_000397.3 | |
| DGKE | Chr17:54925466 | c.888+40A>G | NM_003647.2 | |
| DKC1 | ChrX:153991099 | c.-142C>G | NM_001363.3 | rs199422241 |
| DKC1 | ChrX:153991100 | c.-141C>G | NM_001363.3 | |
| DKC1 | ChrX:153993704 | c.85-15T>C | NM_001363.3 | |
| DNMT3B | Chr20:31395557 | c.2421-11G>A | NM_006892.3 | rs547940069 |
| DOCK8 | Chr9:317025 | c.742-18C>G | NM_203447.3 | rs112373444 |
| DOCK8 | Chr9:317028 | c.742-15T>G | NM_203447.3 | rs111627162 |
| DOCK8 | Chr9:368196 | c.1797+61A>C | NM_203447.3 | rs786205596 |
| EP300 | Chr22:41537040 | c.1879-12A>G | NM_001429.3 | |
| EPCAM | Chr2:47606078 | c.556-14A>G | NM_002354.2 | rs376155665 |
| FANCA | Chr16:89805127 | c.4261-19_4261-12delACCTGCTC | NM_000135.3 | |
| FANCA | Chr16:89816056 | c.3239+82T>G | NM_000135.2 | |
| FANCA | Chr16:89818822 | c.2982-192A>G | NM_000135.2 | |
| FANCA | Chr16:89831215 | c.2778+83C>G | NM_000135.2 | rs750997715 |
| FANCA | Chr16:89836111 | c.2504+134A>G | NM_000135.2 | |
| FANCA | Chr16:89836805 | c.2223-138A>G | NM_000135.2 | |
| FANCA | Chr16:89849346 | c.1567-20A>G | NM_000135.2 | rs775154397 |
| FANCC | Chr9:98011653 | c.-78-2A>G | NM_000136.2 | rs587779898 |
| FANCC | Chr9:98079807 | c.-79+1G>A | NM_000136.2 | |
| FANCD2 | Chr3:10083186 | c.696-121C>G | NM_033084.3 | |
| FANCD2 | Chr3:10102127 | c.1766+40T>G | NM_033084.3 | |
| FANCD2 | Chr3:10106024 | c.1948-16T>G | NM_033084.3 | |
| FANCI | Chr15:89825208 | c.1583+142C>T | NM_001113378.1 | |
| FANCL | Chr2:58433394 | c.375-2033C>G | NM_001114636.1 | |
| FAS | Chr10:90770494 | c.506-16A>G | NM_000043.4 | |
| FASLG | Chr1:172628081 | c.-261T>C | NM_000639.1 | |
| FERMT1 | Chr20:6074846 | c.1139+740G>A | NM_017671.4 | rs869312728 |
| FERMT1 | Chr20:6103422 | c.-20A>G | NM_017671.4 | rs869312722 |
| FLNA | ChrX:153581587 | c.6023-27_6023-16delTGACTGACAGCC | NM_001110556.1 | |
| FOXP3 | ChrX:49121118 | c.-23+5G>A | NM_014009.3 | |
| FOXP3 | ChrX:49121121 | c.-23+2T>G | NM_014009.3 | |
| FOXP3 | ChrX:49121122 | c.-23+1G>A | NM_014009.3 | |
| FOXP3 | ChrX:49121122 | c.-23+1G>T | NM_014009.3 | |
| GATA1 | ChrX:48649496 | c.-19-2A>G | NM_002049.3 | |
| GATA2 | Chr3:128202131 | c.1017+572C>T | NM_032638.4 | |
| GATA2 | Chr3:128202162 | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | NM_032638.4 | |
| GATA2 | Chr3:128202171 | c.1017+532T>A | NM_032638.4 | |
| GBA | Chr1:155205646 | c.1225-14_1225-11delTGTCinsAGT | NM_000157.3 | |
| GBA | Chr1:155208109 | c.589-12C>G | NM_000157.3 | |
| GBA | Chr1:155211053 | c.-150A>G | NM_000157.3 | rs1232943445 |
| GINS1 | Chr20:25388397 | c.-60A>G | NM_021067.3 | |
| GINS1 | Chr20:25388409 | c.-48C>G | NM_021067.3 | |
| HNRNPK | Chr9:86590455 | c.214-35A>G | NM_002140.3 | |
| HPS3 | Chr3:148888270 | c.2888-1612G>A | NM_032383.3 | rs281865096 |
| IL10RB | Chr21:34668714 | c.*52C>T | NM_000628.4 | |
| IL2RG | ChrX:70327277 | c.*307_*308delAA | NM_000206.2 | |
| IL2RG | ChrX:70327278 | c.*308A>G | NM_000206.2 | |
| IL2RG | ChrX:70330553 | c.270-15A>G | NM_000206.2 | |
| IL7R | Chr5:35867853 | c.379+288G>A | NM_002185.3 | |
| ITGA2B | Chr17:42449567 | c.*165T>C | NM_000419.3 | |
| ITGA2B | Chr17:42455177 | c.2095-19T>A | NM_000419.3 | |
| ITGA2B | Chr17:42458507 | c.1211-78A>G | NM_000419.3 | |
| ITGA2B | Chr17:42463181 | c.408+11C>A | NM_000419.3 | |
| ITGA2B | Chr17:42470923 | c.-4082G>A | NM_000419.3 | |
| ITGB2 | Chr21:46320404 | c.742-14C>A | NM_000211.3 | rs183204825 |
| ITGB2 | Chr21:46321660 | c.500-12T>G | NM_000211.3 | |
| JAK3 | Chr19:17943239 | c.2680+89G>A | NM_000215.3 | |
| JAK3 | Chr19:17946035 | c.1915-11G>A | NM_000215.3 | |
| KLF1 | Chr19:12998078 | c.-124T>C | NM_006563.3 | |
| KLF1 | Chr19:12998102 | NM_006563.3 | rs552824864 | |
| KLF1 | Chr19:12998108 | c.-154C>T | NM_006563.3 | rs372651309 |
| KMT2D | Chr12:49428461 | c.10356-12G>A | NM_003482.3 | |
| LAMTOR2 | Chr1:156028185 | c.*23C>A | NM_014017.3 | |
| LZTR1 | Chr22:21336623 | c.-38T>A | NM_006767.3 | |
| LZTR1 | Chr22:21350968 | c.2220-17C>A | NM_006767.3 | rs1249726034 |
| MEFV | Chr16:3306599 | c.-12C>G | NM_000243.2 | rs104895148 |
| MEFV | Chr16:3306969 | c.-382C>G | NM_000243.2 | |
| MLH1 | Chr3:37034619 | c.-413_-411delGAG | NM_000249.3 | rs953169437 |
| MLH1 | Chr3:37034932 | c.-107C>G | NM_000249.3 | rs587778886 |
| MLH1 | Chr3:37034976 | c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA | NM_000249.3 | |
| MLH1 | Chr3:37034997 | c.-42C>T | NM_000249.3 | rs41285097 |
| MLH1 | Chr3:37035012 | c.-27C>A | NM_000249.3 | rs587779001 |
| MLH1 | Chr3:37035260 | c.116+106G>A | NM_000249.3 | |
| MLH1 | Chr3:37038099 | c.117-11T>A | NM_000249.3 | rs267607711 |
| MLH1 | Chr3:37050292 | c.454-13A>G | NM_000249.3 | rs267607749 |
| MLH1 | Chr3:37061788 | c.885-9_887dupTCCTGACAGTTT | NM_000249.3 | rs63751620 |
| MLH1 | Chr3:37070436 | c.1558+13T>A | NM_000249.3 | rs267607834 |
| MSH2 | Chr2:47630106 | c.-225G>C | NM_000251.2 | rs138068023 |
| MSH2 | Chr2:47630150 | c.-181G>A | NM_000251.2 | rs786201698 |
| MSH2 | Chr2:47630249 | c.-81dupA | NM_000251.2 | rs560991330,rs587779187 |
| MSH2 | Chr2:47630251 | c.-78_-77delTG | NM_000251.2 | rs587779182 |
| MSH2 | Chr2:47698086 | c.1662-17dupG | NM_000251.2 | rs587779099 |
| MSH6 | Chr2:48018295 | c.457+33_457+34insGTGT | NM_000179.2 | |
| MSH6 | Chr2:48030536 | c.3173-16_3173-5delCCCTCTCTTTTA | NM_000179.2 | |
| MSH6 | Chr2:48034014 | c.*15A>C | NM_000179.2 | |
| MSH6 | Chr2:48034047 | c.*49_*68dupTTCAGACAACATTATGATCT | NM_000179.2 | rs777409019 |
| MVK | Chr12:110029032 | c.769-7dupT | NM_000431.2 | rs104895348 |
| MYO5B | Chr18:47365503 | c.4852+11A>G | NM_001080467.2 | |
| NBAS | Chr2:15567431 | c.2423+404G>C | NM_015909.3 | |
| NF1 | Chr17:29422055 | c.-273A>C | NM_001042492.2 | |
| NF1 | Chr17:29422056 | c.-272G>A | NM_001042492.2 | |
| NF1 | Chr17:29431417 | c.60+9031_60+9035delAAGTT | NM_001042492.2 | |
| NF1 | Chr17:29475515 | c.61-7486G>T | NM_001042492.2 | |
| NF1 | Chr17:29488136 | c.288+2025T>G | NM_001042492.2 | |
| NF1 | Chr17:29508426 | c.587-14T>A | NM_001042492.2 | |
| NF1 | Chr17:29508428 | c.587-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29510334 | c.888+651T>A | NM_001042492.2 | |
| NF1 | Chr17:29510427 | c.888+744A>G | NM_001042492.2 | |
| NF1 | Chr17:29510472 | c.888+789A>G | NM_001042492.2 | |
| NF1 | Chr17:29527428 | c.889-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29530107 | c.1260+1604A>G | NM_001042492.2 | |
| NF1 | Chr17:29533239 | c.1261-19G>A | NM_001042492.2 | |
| NF1 | Chr17:29534143 | c.1392+754T>G | NM_001042492.2 | |
| NF1 | Chr17:29540877 | c.1393-592A>G | NM_001042492.2 | |
| NF1 | Chr17:29542762 | c.1527+1159C>T | NM_001042492.2 | |
| NF1 | Chr17:29548419 | c.1642-449A>G | NM_001042492.2 | rs863224655 |
| NF1 | Chr17:29549489 | c.*481A>G | NM_001128147.2 | |
| NF1 | Chr17:29553439 | c.2002-14C>G | NM_001042492.2 | |
| NF1 | Chr17:29554225 | c.2252-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29556025 | c.2410-18C>G | NM_001042492.2 | |
| NF1 | Chr17:29556027 | c.2410-16A>G | NM_001042492.2 | |
| NF1 | Chr17:29556028 | c.2410-15A>G | NM_001042492.2 | |
| NF1 | Chr17:29556031 | c.2410-12T>G | NM_001042492.2 | |
| NF1 | Chr17:29556839 | c.2851-14_2851-13insA | NM_001042492.2 | |
| NF1 | Chr17:29557267 | c.2991-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29563299 | c.3974+260T>G | NM_001042492.2 | |
| NF1 | Chr17:29577082 | c.4110+945A>G | NM_001042492.2 | |
| NF1 | Chr17:29580296 | c.4173+278A>G | NM_001042492.2 | |
| NF1 | Chr17:29588708 | c.4578-20_4578-18delAAG | NM_001042492.2 | |
| NF1 | Chr17:29588715 | c.4578-14T>G | NM_001042492.2 | |
| NF1 | Chr17:29654479 | c.5269-38A>G | NM_001042492.2 | |
| NF1 | Chr17:29656858 | c.5610-456G>T | NM_001042492.2 | |
| NF1 | Chr17:29657848 | c.5812+332A>G | NM_001042492.2 | rs863224491 |
| NF1 | Chr17:29661577 | c.5813-279A>G | NM_001042492.2 | |
| NF1 | Chr17:29664375 | c.6428-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29664618 | c.6642+18A>G | NM_001042492.2 | |
| NF1 | Chr17:29676126 | c.7190-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29676127 | c.7190-11_7190-10insGTTT | NM_001042492.2 | |
| NF1 | Chr17:29685177 | c.7971-321C>G | NM_001042492.2 | |
| NF1 | Chr17:29685481 | c.7971-17C>G | NM_001042492.2 | |
| NF1 | Chr17:29685665 | c.8113+25A>T | NM_001042492.2 | |
| OFD1 | ChrX:13768358 | c.935+706A>G | NM_003611.2 | rs730880283 |
| OFD1 | ChrX:13773245 | c.1130-22_1130-19delAATT | NM_003611.2 | rs312262865 |
| OFD1 | ChrX:13773249 | c.1130-20_1130-16delTTGGT | NM_003611.2 | |
| PALB2 | Chr16:23649285 | c.109-12T>A | NM_024675.3 | rs774949203 |
| PARN | Chr16:14724045 | c.-165+2C>T | NM_001134477.2 | |
| PMM2 | Chr16:8891573 | NM_000303.2 | ||
| PMM2 | Chr16:8898599 | c.179-25A>G | NM_000303.2 | rs760689221 |
| PMM2 | Chr16:8926102 | c.640-15479C>T | NM_000303.2 | rs1258107584 |
| PMM2 | Chr16:8941558 | c.640-23A>G | NM_000303.2 | |
| PMS2 | Chr7:6027263 | c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC | NM_000535.5 | rs751973268 |
| PMS2 | Chr7:6048599 | c.23+21_23+28delTCCGGTGT | NM_000535.5 | |
| PNP | Chr14:20942914 | c.286-18G>A | NM_000270.3 | |
| POLA1 | ChrX:24744696 | c.1375-354A>G | NM_016937.3 | rs869312979 |
| POLE | Chr12:133249181 | c.1686+32C>G | NM_006231.2 | rs762985435 |
| POLR3A | Chr10:79737218 | c.*18C>T | NM_007055.3 | |
| POLR3A | Chr10:79743781 | c.3337-11T>C | NM_007055.3 | |
| POLR3A | Chr10:79769273 | c.1909+22G>A | NM_007055.3 | rs191875469 |
| POLR3A | Chr10:79769277 | c.1909+18G>A | NM_007055.3 | rs267608677 |
| POMP | Chr13:29233225 | c.-95delC | NM_015932.5 | rs112368783 |
| PSEN1 | Chr14:73673071 | c.869-23_869-22insTGGAATTTTGTGCTGTTG | NM_000021.3 | |
| PSENEN | Chr19:36236501 | c.-192_-190delAGA | NM_172341.2 | rs554724520 |
| PTEN | Chr10:89622883-89623482 | |||
| PTEN | Chr10:89622988 | c.-1239A>G | NM_000314.6 | |
| PTEN | Chr10:89623049 | c.-1178C>T | NM_000314.6 | |
| PTEN | Chr10:89623056 | c.-1171C>T | NM_000314.6 | rs587779981 |
| PTEN | Chr10:89623116 | c.-1111A>G | NM_000314.6 | |
| PTEN | Chr10:89623226 | c.-1001T>C | NM_000314.4 | |
| PTEN | Chr10:89623296 | c.-931G>A | NM_000314.4 | rs587781959 |
| PTEN | Chr10:89623306 | c.-921G>T | NM_000314.4 | |
| PTEN | Chr10:89623331 | c.-896T>C | NM_000314.4 | |
| PTEN | Chr10:89623365 | c.-862G>T | NM_000314.4 | rs587776675 |
| PTEN | Chr10:89623373 | c.-854C>G | NM_000314.4 | |
| PTEN | Chr10:89623392 | c.-835C>T | NM_000314.4 | rs587779994 |
| PTEN | Chr10:89623428 | c.-799G>C | NM_000314.4 | rs587779992 |
| PTEN | Chr10:89623462 | c.-765G>A | NM_000314.4 | |
| PTEN | Chr10:89690791 | c.210-8dupT | NM_000314.4 | |
| PTEN | Chr10:89692749 | c.254-21G>C | NM_000314.4 | |
| PTEN | Chr10:89725294 | c.*65T>A | NM_000314.4 | |
| PTEN | Chr10:89725304 | c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG | NM_000314.4 | |
| PTPN11 | Chr12:112915602 | c.934-59T>A | NM_002834.3 | |
| RAG2 | Chr11:36619652 | c.-28G>C | NM_000536.3 | |
| RBM8A | Chr1:145507646 | c.-21G>A | NM_005105.4 | |
| RBM8A | Chr1:145507765 | c.67+32G>C | NM_005105.4 | rs201779890 |
| RFXANK | Chr19:19307761 | c.188-11C>T | NM_003721.3 | rs201545133 |
| RMRP | Chr9:35658026 | NR_003051.3 | rs781730798 | |
| RMRP | Chr9:35658026 | NR_003051.3 | ||
| RMRP | Chr9:35658026 | NR_003051.3 | ||
| RMRP | Chr9:35658026 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658027 | NR_003051.3 | rs727502775 | |
| RMRP | Chr9:35658027 | NR_003051.3 | ||
| RMRP | Chr9:35658028 | NR_003051.3 | ||
| RMRP | Chr9:35658028 | NR_003051.3 | ||
| RMRP | Chr9:35658029 | NR_003051.3 | ||
| RMRP | Chr9:35658029 | NR_003051.3 | ||
| RMRP | Chr9:35658032 | NR_003051.3 | ||
| RNASEH2B | Chr13:51501530 | c.65-13G>A | NM_024570.3 | |
| RNASEH2B | Chr13:51519550 | c.511-13G>A | NM_024570.3 | |
| RPGR | ChrX:38128234 | NM_000328.2 | ||
| RPGR | ChrX:38160137 | c.1059+363G>A | NM_001034853.1 | |
| RPL5 | Chr1:93300322 | c.190-12_191dupCTCTTACTATAGAT | NM_000969.3 | |
| RPS19 | Chr19:42364214 | c.-144_-141delTTTC | NM_001022.3 | |
| RPS26 | Chr12:56436176 | c.4-25_4-14delTAACAGTTTTCC | NM_001029.3 | |
| RPS7 | Chr2:3622941 | c.-19+1G>T | NM_001011.3 | |
| RPS7 | Chr2:3622942 | c.-19+2T>C | NM_001011.3 | |
| RPSA | Chr3:39448260 | c.-34+5G>C | NM_002295.4 | |
| SEC23B | Chr20:18488060 | c.-571A>G | NM_006363.4 | rs559854357 |
| SEC23B | Chr20:18488615 | c.-16A>G | NM_006363.4 | |
| SEC23B | Chr20:18491731 | c.221+31A>G | NM_006363.4 | |
| SEC23B | Chr20:18491863 | c.221+163A>G | NM_006363.4 | rs573898514 |
| SEC23B | Chr20:18492791 | c.222-78C>T | NM_006363.4 | rs150393520 |
| SEC23B | Chr20:18526845 | c.1743+168A>G | NM_006363.4 | rs111951711 |
| SERPING1 | Chr11:57365055 | c.-163C>T | NM_000062.2 | |
| SERPING1 | Chr11:57365057 | c.-161A>G | NM_000062.2 | |
| SERPING1 | Chr11:57365118 | c.-100C>G | NM_000062.2 | rs578018379 |
| SERPING1 | Chr11:57365720 | c.-22-2A>C | NM_000062.2 | |
| SERPING1 | Chr11:57365720 | c.-22-2A>G | NM_000062.2 | |
| SERPING1 | Chr11:57365721 | c.-22-1G>A | NM_000062.2 | |
| SERPING1 | Chr11:57373471 | c.686-12A>G | NM_000062.2 | |
| SERPING1 | Chr11:57373867 | c.890-14C>G | NM_000062.2 | |
| SERPING1 | Chr11:57381788 | c.1250-13G>A | NM_000062.2 | |
| SH2D1A | ChrX:123499593 | c.138-17_138-11delAGTTTAT | NM_002351.4 | |
| SLC29A3 | Chr10:73122778 | c.*413G>A | NM_018344.5 | |
| SLC39A4 | Chr8:145641963 | c.192+19G>A | NM_130849.3 | rs368996660 |
| SPINK5 | Chr5:147465956 | c.283-12T>A | NM_006846.3 | |
| SPINK5 | Chr5:147484503 | c.1431-12G>A | NM_006846.3 | rs368134354 |
| SPINK5 | Chr5:147491511 | c.1820+53G>A | NM_006846.3 | rs754599628 |
| STX11 | Chr6:144508713 | c.*85_*86insT | NM_003764.3 | |
| STXBP2 | Chr19:7705761 | c.326-23_326-16delGCCCCACT | NM_006949.3 | |
| TAZ | ChrX:153641699 | n.694+4G>A | NR_024048.1 | |
| TAZ | ChrX:153649161 | c.778-63_778-51delCTCCCAGGGCACC | NM_000116.3 | rs782249471 |
| TBX1 | Chr22:19743578 | c.-777C>T | NM_080647.1 | |
| TBX1 | Chr22:19743735 | c.-620A>C | NM_080647.1 | rs536892777 |
| TCIRG1 | Chr11:67806587 | c.-5+1G>C | NM_006019.3 | |
| TCIRG1 | Chr11:67806587 | c.-5+1G>T | NM_006019.3 | |
| TCIRG1 | Chr11:67816893 | c.1887+132T>C | NM_006019.3 | |
| TCIRG1 | Chr11:67816903 | c.1887+142T>A | NM_006019.3 | |
| TCIRG1 | Chr11:67816907 | c.1887+146G>A | NM_006019.3 | |
| TCIRG1 | Chr11:67816910 | c.1887+149C>T | NM_006019.3 | |
| TCN2 | Chr22:31011112 | c.581-176A>T | NM_000355.3 | |
| TCN2 | Chr22:31011112 | c.581-176A>G | NM_000355.3 | rs372866837 |
| TERC | Chr3:169482870 | n.-22C>T | NR_001566.1 | |
| TERC | Chr3:169482906 | NR_001566.1 | ||
| TERC | Chr3:169482948 | n.-100C>G | NR_001566.1 | rs199422256 |
| TERC | Chr3:169483086 | NR_001566.1 | rs199422255 | |
| TERT | Chr5:1271334 | c.2383-15C>T | NM_198253.2 | rs574645600 |
| TERT | Chr5:1295161 | c.-57A>C | NM_198253.2 | |
| TGFBR2 | Chr3:30648317 | c.-59C>T | NM_001024847.2 | |
| THBD | Chr20:23030319 | NM_000361.2 | ||
| THBD | Chr20:23030443 | c.-302C>A | NM_000361.2 | |
| TP53 | Chr17:7571520 | NM_000546.5 | ||
| TP53 | Chr17:7577647 | c.673-39G>A | NM_000546.5 | |
| TP53 | Chr17:7579601 | c.97-11C>G | NM_000546.5 | |
| TP53 | Chr17:7590694 | c.-29+1G>T | NM_000546.5 | |
| TRNT1 | Chr3:3188088 | c.609-26T>C | NM_182916.2 | |
| TTC7A | Chr2:47249223 | c.1510+105T>A | NM_020458.2 | |
| UNC13D | Chr17:73826245 | c.2831-13G>A | NM_199242.2 | |
| UNC13D | Chr17:73827442 | c.2448-13G>A | NM_199242.2 | rs753762300 |
| UNC13D | Chr17:73839907 | c.118-307G>A | NM_199242.2 | |
| UNC13D | Chr17:73839908 | c.118-308C>T | NM_199242.2 | |
| WAS | ChrX:48547690 | c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC | NM_000377.2 | |
| ZAP70 | Chr2:98349927 | c.838-80G>A | NM_001079.3 | rs113994173 |
| ZAP70 | Chr2:98354447 | c.1624-11G>A | NM_001079.3 | rs730880318 |
Test Strengths
The strengths of this test include:
- CAP accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
- Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
- ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ARMC4 NM_001290021.2:13;NM_018076.5:9, C5 NM_001317164.2:21, CD55 NM_001300902.2:10;NM_001300903.2:10, CHEK2 NM_001005735.2:3, CORO1A NM_007074.4:11, CSF2RA NM_001161530.2:11, HYDIN NM_001270974.2:6,8,12,18,20,21,23,26,27,31,35,37,45,47,50,52,57,58,64,70,75,78,82,83, IL12RB1 NM_153701.3:10, IL6R NM_001206866.2:7, ITCH NM_001257137.3:7, NCF1 NM_000265.7:1,5,8,9,11, PGM3 NM_001199919.2:14, PMS2 NM_000535.7:13-15, RAD51 NM_133487.4:4, REL NM_002908.4:9, RPL15 NM_001253384.2:5, TNFRSF1A NM_001346092.2:6, USP18 NM_017414.4:11, VPS45 NM_001279353.2:13. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Small deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.
We utilize whole exome capture technology and Next-Generation Sequencing methods to obtain clinical-grade WES data, maximizing coverage of clinically relevant genes. The performance metrics listed below are from validation performed at our laboratory in Finland.
- Highly uniform sequencing depth across all protein-coding genes of the genome
-
-
- Mean sequencing coverage on average 154x at 100M sequenced reads
- On average, 99.6% of base pairs in target region is covered at least 20x
- Target region: protein coding exons extending ±20 base pairs to intron-exon boundaries and ~2,000 intronic regions know to contain medically relevant variants
-
-
- Highly sensitive and specific detection of single-nucleotide variants and indels (GIAB 4.2.1)
- 99.1% (99.8%*) sensitivity and >99.99% specificity for detecting single-nucleotide variants within target region
- 95.0% (94.5%*) sensitivity and >99.99% specificity for indel (≤ 50 bps) detection within target region
- Range of detected indels in validation: Deletions up to 1-245bp detected, insertions 1-200bp
- Assay performs with high precision
- Within-run precision (repeatability) 99.1%, intermediate precision (reproducibility) 99.0%
- Sensitive and specific detection of copy number variants (CNVs)
-
- Values indicated with * were generated using previous version (v3.3.2) of benchmark data. Version 4.2.1 is extended to included challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information see https://doi.org/10.1016/j.xgen.2022.100128In validation single exon deletion (and larger) events were detected at 100% sensitivity.Segmentally duplicated genomic regions may have reduced sensitivity. The exact boundaries of the copy number aberration cannot be determined with this test
-
Analytical sensitivity to detect single-nucleotide variants and indels were calculated using latest version of high-confidence benchmark data provided byGenome in a Bottle (v4.2.1).
Values indicated with * were generated using previous version (v3.3.2) of benchmark data. Version 4.2.1 is extended to included challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information see https://doi.org/10.1016/j.xgen.2022.100128
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.
Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.
Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.
The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.
Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.