Comprehensive Hereditary Cancer Panel

Summary
Is a 160 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of inherited susceptibility to cancer. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
160
Test code
ON1001
Panel size
Large
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.
** CPT coding is dependent on patient history and payer being billed.

Summary

The Blueprint Genetics Comprehensive Hereditary Cancer Panel (test code ON1001):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in *PTEN*.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Hereditary cancer syndromes account for approximately 5-10% of all cancer. These cancers originate from the gastrointestinal tract, endocrine and neuroendocrine systems or from different organs like lung, kidneys, liver, pancreas, skin, and eyes. Hereditary cancer is suspected when there are multiple relatives on the same side of the family with the same or related forms of cancer, cancer at an early age or multiple primary cancers in an individual. The most common inherited cancer syndromes are hereditary breast and ovarian cancer syndrome, Lynch syndrome (also known as hereditary non-polyposis colorectal cancer), Li-Fraumeni syndrome, PTEN hamartoma tumor syndrome, familial adenomatous polyposis, Von-Hippel Lindau syndrome, and multiple endocrine neoplasia type 1 and type 2. Most of the hereditary cancer syndromes are inherited in an autosomal dominant manner and penetrance is high. Genetic testing is the most effective way to identify individuals with a genetic predisposition to develop cancer. Accurate genetic diagnosis enables personal cancer risk assessment and inherited genetic variant can be taken into account when planning the treatment and the follow-up of both unaffected and affected persons. In most of the cases, cancer mortality can be significantly reduced in high-risk individuals by regular surveillance and preventive strategies.

Genes in the Comprehensive Hereditary Cancer Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
AIP Pituitary adenoma, familial isolated AD 53 110
ALK Neuroblastoma AD 31 15
ANKRD26 Thrombocytopenia AD 6 21
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 773 1926
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
AXIN2 Oligodontia-colorectal cancer syndrome, Oligondontia, isolated AD 19 18
BAP1 Tumor predisposition syndrome, Neurodevelopmental disorder AD 74 113
BARD1 Breast cancer AD 159 114
BLM Bloom syndrome AR 152 119
BMPR1A* Polyposis, juvenile intestinal AD 110 140
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 134 65
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial, Fanconi anemia AD/AR 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 3369 2659
BRIP1 Fanconi anemia, Ovarian cancer, familial AD/AR 238 189
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 14 28
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 24 43
CD70 Primary immunodeficiency AR 4
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 50 101
CDH1 CDH1-related cancer, Blepharocheilodontic syndrome 1 AD 178 242
CDK4 Melanoma, cutaneous malignant AD 4 14
CDKN1B Multiple endocrine neoplasia AD 13 20
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 35 81
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 87 232
CEBPA Acute myeloid leukemia, familial AD 15 13
CEP57 Mosaic variegated aneuploidy syndrome AR 5 5
CHEK2#* Breast cancer, susceptibility to AD/AR 275 197
CTNNA1 Macular dystrophy, patterned 2, Hereditary diffuse gastric cancer AD 6 10
CYLD Spiegler-Brooke syndrome, Trichoepithelioma, multiple, Cylindromatosis AD 34 106
DDB2 Xeroderma pigmentosum AR 4 17
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to AD 9 21
DICER1* DICER1 syndrome AD 197 137
DIS3L2* Perlman syndrome AR 12 14
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 48 74
EFL1* Shwachman-Diamond syndrome AR 3 2
EGFR Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial AD/AR 55 18
ELANE Neutropenia AD 43 217
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
ERCC1 Cerebrooculofacioskeletal syndrome 4 AR 8 5
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive, Cerebrooculofacioskeletal syndrome 2 AR 26 98
ERCC3 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 10 19
ERCC4 Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome AR 13 70
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 21 54
ETV6 Thrombocytopenia 5 AD 10 38
EXO1 AD/AR 1 14
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
EXT2 Multiple cartilagenious exostoses 2, Seizures, scoliosis, and macrocephaly syndrome AD/AR 45 250
EZH2 Weaver syndrome AD 29 41
FAM111B* Hereditary Fibrosing Poikiloderma with Tendon Contracture, Myopathy, and Pulmonary Fibrosis, Lung cancer, familial, susceptibilty to AD 7 7
FANCA Fanconi anemia AR 191 677
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FANCD2* Fanconi anemia AR 21 61
FANCE Fanconi anemia AR 4 17
FANCF Fanconia anemia AR 7 16
FANCG Fanconi anemia AR 16 92
FANCI Fanconi anemia AR 13 45
FANCL Fanconi anemia AR 13 24
FANCM Premature ovarian failure AR 6 50
FH Hereditary leiomyomatosis and renal cell cancer, Fumarase deficiency AD/AR 178 207
FLCN Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous AD 154 210
GALNT12 Colorectal cancer, susceptibility to, 1, Inflammatory bowel disease AD 8
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GPC3 Simpson-Golabi-Behmel syndrome XL 33 75
GPR101 Pituitary adenoma, growth hormone secreting, 2 XL 17
GREM1 Hereditary mixed polyposis syndrome AD/AR 1 8
HAVCR2 AR
HNF1A Maturity onset diabetes of the young AD 78 528
HOXB13 Familial prostate cancer AD 1 5
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 43 31
IKZF1 Immunodeficiency, common variable, 13 AD 10 35
KIF1B Pheochromocytoma, Neuroblastoma, Charcot-Marie-Tooth disease, type 2A1 AD 7 12
KIT Gastrointestinal stromal tumor, Piebaldism AD 79 116
KITLG Hyperpigmentation with or without hypopigementation, familial progressive, Deafness, autosomal dominant 69, Waardenburg syndrome AD/AR 6 10
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LZTR1 Schwannomatosis, Noonan syndrome AD/AR 34 71
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MAX Pheochromocytoma AD 13 31
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 263 730
MET Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to AD/AR 20 34
MITF Tietz albinism-deafness syndrome, Waardenburg syndrome, Coloboma, osteopetrosis, microphthalmia, macrocephaly, albinism, and deafness (COMMAD) AD/AR 32 58
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MLH3 Colorectal cancer, hereditary nonpolyposis AD/AR 7 31
MRE11A Ataxia-telangiectasia-like disorder-1 AR 57 56
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH3 Colorectal adenomatous polyposis, autosomal recessive, with pilomatricomas AR 4 22
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
MUTYH Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas AR 134 168
NBN Breast cancer, Nijmegen breakage syndrome AR 188 97
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NF2 Schwannomatosis, Neurofibromatosis AD 66 433
NRAS Noonan syndrome AD 31 14
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 329 517
NSUN2 Dubowitz syndrome, Non-syndromic intellectual disability AR 8 7
NTHL1 Familial adenomatous polyposis 3 AR 7 3
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PAX5 Pre-B cell acute lymphoblastic leukemia AD 7
PDGFRA# Gastrointestinal stromal tumor AD 22 19
PHOX2B Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease AD 11 86
PMS1# AD/AR 1 32
PMS2#* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
POLD1 Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency AD/AR 3 31
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 8 70
POLH* Xeroderma pigmentosum, variant type AR 20 78
POT1 Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 AD 2 34
PPM1D Intellectual developmental disorder AD 16 60
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 24 183
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
PTCH1 Basal cell nevus syndrome AD 193 522
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 435 638
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
RAD50 Nijmegen breakage syndrome-like disorder AR 183 88
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RAD51D Breast-ovarian cancer, familial AD 77 78
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 45 53
RASA2 Noonan syndrome AD 1 3
RB1 Retinoblastoma AD 266 1102
RECQL* Breast cancer AD 9 27
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
REST Fibromatosis, gingival, 5, Wilms tumor 6, susceptibility to AD 3 16
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD 122 407
RHBDF2 Tylosis with esophageal cancer AD 2 4
RIT1 Noonan syndrome AD 23 26
RPS20 Colorectal cancer AD 1
RRAS Noonan-syndrome like phenotype AD/AR 2
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SAMD9 Mirage syndrome, Tumoral calcinosis, normophosphatemic AD/AR 10 27
SAMD9L Ataxia-pancytopenia syndrome AD 4 16
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AR 19 90
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 54 87
SDHAF2 Paragangliomas AD 4 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD/AR 151 272
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 29 60
SDHD# Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 68 170
SHOC2 Noonan-like syndrome with loose anagen hair AD 2 4
SLX4 Fanconi anemia AR 18 72
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMARCA4 Rhabdoid tumor predisposition syndrome AD 76 57
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 AD 36 118
SMARCE1 Coffin-Siris syndrome AD 14 12
SOS1 Noonan syndrome AD 44 71
SOS2 Noonan syndrome 9 AD 4 6
SPRED1 Legius syndrome AD 38 71
SRP72* Bone marrow failure syndrome 1 AD 2 5
STK11 Peutz-Jeghers syndrome AD 173 460
SUFU Medulloblastoma, Basal cell nevus syndrome AD 22 44
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TMEM127 Pheochromocytoma AD 30 52
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
TRIP13 Mosaic variegated aneuploidy syndrome 3 2 2
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 177 372
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 396 1195
VHL Erythrocytosis, familial, Pheochromocytoma, Von Hippel-Lindau disease AD/AR 206 614
WRN* Werner syndrome AR 64 107
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 AD 42 183
XPA Xeroderma pigmentosum AR 49 47
XPC Xeroderma pigmentosum AR 67 91
XRCC2 Hereditary breast cancer AD/AR 10 21
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Hereditary Cancer Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
AIP Chr11:67250360 NM_003977.2 rs267606588
AIP Chr11:67250410 c.-220G>A NM_003977.2 rs267606540
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
APC Chr5:112043009-112043595
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043223 c.-192A>G NM_001127511.2 rs879253784
APC Chr5:112043223 c.-192A>T NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112072710-112073585
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BAP1 Chr3:52435659 c.*644delG NM_004656.3
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
BUB1B Chr15:40409289 c.-44133G>A NM_001211.5 rs576524605
BUB1B Chr15:40504689 c.2386-11A>G NM_001211.5 rs751421137
CDH1 Chr16:68842843 c.687+92T>A NM_004360.3
CDKN1B Chr12:12870317 c.-454_-451delTTCC NM_004064.3 rs786201010
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
CYLD Chr16:50813428 c.1139-148A>G NM_015247.2
DICER1 Chr14:95559038 c.5364+1187T>G NM_177438.2
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
ERCC1 Chr19:45918244 c.603-26G>A NM_202001.2 rs367887072
ERCC5 Chr13:103514354 c.881-26T>G NM_000123.3
FANCA Chr16:89805127 c.4261-19_4261-12delACCTGCTC NM_000135.3
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FANCD2 Chr3:10083186 c.696-121C>G NM_033084.3
FANCD2 Chr3:10102127 c.1766+40T>G NM_033084.3
FANCD2 Chr3:10106024 c.1948-16T>G NM_033084.3
FANCI Chr15:89825208 c.1583+142C>T NM_001113378.1
FANCL Chr2:58433394 c.375-2033C>G NM_001114636.1
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
HNF1A Chr12:121416034 c.-538G>C NM_000545.5
HNF1A Chr12:121416110 c.-462G>A NM_000545.5
HNF1A Chr12:121416281 c.-291T>C NM_000545.5 rs534474388
HNF1A Chr12:121416285 c.-287G>A NM_000545.5
HNF1A Chr12:121416285 NM_000545.5
HNF1A Chr12:121416289 c.-283A>C NM_000545.5
HNF1A Chr12:121416314 c.-258A>G NM_000545.5 rs756136537
HNF1A Chr12:121416354 c.-218T>C NM_000545.5
HNF1A Chr12:121416385 c.-187C>A/T NM_000545.5
HNF1A Chr12:121416385 NM_000545.5
HNF1A Chr12:121416385 NM_000545.5 rs970766228
HNF1A Chr12:121416391 NM_000545.5
HNF1A Chr12:121416437 NM_000545.5
HNF1A Chr12:121416446 NM_000545.5 rs780586155
HNF1A Chr12:121416453 c.-119G>A NM_000545.5 rs371945966
HNF1A Chr12:121416475 c.-97T>G NM_000545.5
HNF1A Chr12:121416508 NM_000545.5
LZTR1 Chr22:21336623 c.-38T>A NM_006767.3
LZTR1 Chr22:21350968 c.2220-17C>A NM_006767.3 rs1249726034
MEN1 Chr11:64571394 c.*412G>A NM_000244.3
MEN1 Chr11:64575165 c.670-15_670-14delTC NM_000244.3
MEN1 Chr11:64577602 c.-23-11_-22delTTGCCTTGCAGGC NM_000244.3
MEN1 Chr11:64577603 c.-23_-22insT NM_000244.3
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
MUTYH Chr1:45797534 c.998-13T>G NM_001128425.1
MUTYH Chr1:45798558 c.504+19_504+31delTAGGGGAAATAGG NM_001128425.1 rs781222233
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
NSUN2 Chr5:6622224 c.538-11T>G NM_017755.5
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PDGFRA Chr4:55161473 c.*34G>A NM_006206.4 rs552950826
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
POLE Chr12:133249181 c.1686+32C>G NM_006231.2 rs762985435
POLH Chr6:43544178 c.-5+1G>C NM_006502.2
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89622883-89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623392 c.-835C>T NM_000314.4 rs587779994
PTEN Chr10:89623428 c.-799G>C NM_000314.4 rs587779992
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89690791 c.210-8dupT NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTEN Chr10:89725294 c.*65T>A NM_000314.4
PTEN Chr10:89725304 c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG NM_000314.4
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RB1 Chr13:48877814 NM_000321.2 rs576931877
RB1 Chr13:48877836 NM_000321.2
RB1 Chr13:48877837 c.-212G>A NM_000321.2
RB1 Chr13:48877851 c.-198G>A NM_000321.2 rs387906521
RB1 Chr13:48877851 c.-198G>T NM_000321.2
RB1 Chr13:48877852 c.-197G>A NM_000321.2
RB1 Chr13:48877853 NM_000321.2
RB1 Chr13:48877856 c.-193T>A/G NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877857 c.-192G>A NM_000321.2
RB1 Chr13:48877860 c.-189G>T NM_000321.2 rs387906520
RB1 Chr13:48877899 c.-150G>C NM_000321.2
RB1 Chr13:48877900 c.-149G>T NM_000321.2
RB1 Chr13:48921946 c.501-15T>G NM_000321.2
RB1 Chr13:48930735 c.608-3418A>G NM_000321.2
RB1 Chr13:48937921 c.861+828T>G NM_000321.2
RB1 Chr13:48947691 c.1215+63T>G NM_000321.2
RB1 Chr13:48954175 c.1390-14A>G NM_000321.2 rs9535023
RB1 Chr13:48954239 c.1421+20_1421+33delTAAAAAATTTTTTT NM_000321.2
RB1 Chr13:49027115 c.1696-14C>T NM_000321.2 rs776912915
RB1 Chr13:49027117 c.1696-12T>G NM_000321.2
RB1 Chr13:49030329 c.1815-11A>G NM_000321.2
RB1 Chr13:49039121 c.2212-13T>A NM_000321.2
RB1 Chr13:49039327 c.2326-14T>C NM_000321.2
RB1 Chr13:49046098 c.2490-1398A>G NM_000321.2
RB1 Chr13:49047468 c.2490-28T>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C/G/T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>G NM_000321.2
REST Chr4:57793760 c.983-2247C>G NM_005612.4
RET Chr10:43572670 c.-37G>C NM_020975.4 rs751005619
RET Chr10:43572680 c.-27C>G NM_020975.4
RET Chr10:43582162 c.73+9385_73+9395delAGCAACTGCCA NM_020975.4 rs368137511
RET Chr10:43606948 c.1522+35C>T NM_020975.4 rs377130948
RET Chr10:43612192 c.2284+13C>T NM_020975.4
RET Chr10:43612198 c.2284+19C>T NM_020975.4
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
SMARCB1 Chr22:24130008 c.93+559A>G NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
STK11 Chr19:1220520 c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG NM_000455.4
STK11 Chr19:1220530 c.598-32_597+31delGCCCCCTCCCGGGC NM_000455.4
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TSC1 Chr9:135800306 c.363+668G>A NM_000368.4
TSC2 Chr16:2106052 c.600-145C>T NM_000548.3
TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3
VHL Chr3:10191719 c.*70C>A NM_000551.3
VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4
XPA Chr9:100449555 c.390-12A>G NM_000380.3
XPC Chr3:14187285 c.*156G>A NM_004628.4 rs121965092
XPC Chr3:14209904 c.413-24A>G NM_004628.4 rs794729657

Test Strengths

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in *PTEN*.

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CHEK2 NM_001005735.2:3, PDGFRA NM_001347828.2:2, PMS1 NM_001321051.2:5, PMS2 NM_000535.7:13-15, SDHD NM_001276506.2:4. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Small deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases, and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis includes a combination of both sequence variants (single nucleotide variants (SNV’s) and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter paper cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.

Other