Arthrogryposes Panel

Summary
Is a 78 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of arthrogryposis or fetal akinesia.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
78
Test code
MA0501
Panel tier
Tier 4
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Arthrogryposes Panel (test code MA0501):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

All exons of the *GBA* gene have segmentally duplicated pseudogenes that reduce sensitivity of NGS diagnostics in general. However, Blueprint Genetics custom assay has good coverage (>20x) with high mapping rates (mapping quality >40) for 100.0% of the target regions in *GBA* gene. Our validation showed high mean coverage of 184X for the *GBA* gene. Thus, our NGS Panel is not expected to have major limitations in detecting variants in *GBA* gene although clinical validation has not been performed at large scale for Gaucher disease.

Deletion / duplication analysis (either in isolation or as part of Plus analysis including sequencing) testing can detect the copy number of *SMN1* exon 7, which is commonly used as a marker for copy number of the *SMN1* gene. In individuals identified to have homozygous *SMN1* deletions, we include reporting of *SMN2* copy number.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Arthrogryposis (also known as arthrogryposis multiplex congenita, AMC) is characterized by congenital contractures of 2 or more different body areas without a primary neurologic or muscle disease. Children born with joint contractures have abnormal fibrosis of the muscle tissue causing muscle shortening, and therefore are unable to perform passive extension and flexion in the affected joints. Arthrogryposis has been divided into three groups: amyoplasia, distal arthrogryposis, and syndromic. Amyoplasia is characterized by severe joint contractures and muscle weakness while distal arthrogryposis mainly involves the hands and feet. Syndromic arthrogryposis consists with a primary neurological or muscle disease. 70-80% of arthrogryposes are caused by neurological abnormalities and most types that have primary neurological or muscle disease result from an underlying genetic syndrome. More than 35 specific genetic disorders associated with arthrogryposis have been described. Fetal akinesia deformation sequence syndrome (FADS) is characterised by decreased fetal movement (fetal akinesia) as well as intrauterine growth restriction, arthrogryposis, and developmental anomalies.

Genes in the Arthrogryposes Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ACTA1 Myopathy AD/AR 68 212
ADGRG6 Lethal congenital contracture syndrome 9 AR 4 4
AGRN Myasthenic syndrome, congenital AR 14 16
BIN1 Myopathy, centronuclear AD/AR 9 15
CACNA1E Epileptic encephalopathy AD 8 6
CASK Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia, FG syndrome, Intellectual developmental disorder XL 87 112
CFL2 Nemaline myopathy AR 2 9
CHAT Myasthenic syndrome, congenital AR 24 73
CHRNA1 Myasthenic syndrome, congenital AD/AR 28 35
CHRNB1 Myasthenic syndrome AD/AR 11 11
CHRND Myasthenic syndrome AD/AR 18 26
CHRNE Myasthenic syndrome AD/AR 48 134
CHRNG Multiple pterygium syndrome, Escobar syndrome AR 17 34
CHST14 Ehlers-Danlos syndrome, musculocontractural AR 15 21
CHUK Cocoon syndrome AR 2 5
CNTNAP1 Lethal congenital contracture syndrome 7 AR 10 21
COL6A2 Epilepsy, progressive myoclonic, Bethlem myopathy, Myosclerosis, congenital, Ullrich congenital muscular dystrophy AD/AR 101 182
COLQ Myasthenic syndrome, congenital AR 23 67
DHCR24 Desmosterolosis AR 6 9
DOK7 Myasthenic syndrome, congenital AR 28 75
DPAGT1 Congenital disorder of glycosylation, Myasthenic syndrome, congenital AR 16 32
ECEL1 Arthrogryposis AR 25 31
EGR2 Neuropathy, Dejerine-Sottas disease, Charcot-Marie-Tooth disease AD/AR 13 21
ERBB3 Lethal congenital contractural syndrome 2 AR 11 4
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 21 54
ERCC6* Xeroderma Pigmentosum-Cockayne Syndrome, De Sanctis-Cacchione syndrome AD/AR 87 135
EXOSC3 Pontocerebellar hypoplasia AR 11 19
FBN2 Congenital contractural arachnodactyly (Beals syndrome) AD 50 97
FHL1* Myopathy with postural muscle atrophy, Emery-Dreifuss muscular dystrophy, Reducing bod myopathy XL 26 62
FKBP10 Bruck syndrome 1, Osteogenesis imperfecta, type XI AR 20 44
FKTN Muscular dystrophy-dystroglycanopathy, Dilated cardiomyopathy (DCM), Muscular dystrophy-dystroglycanopathy (limb-girdle) AR 45 58
FLVCR2 Proliferative vasculopathy and hydraencephaly-hydrocephaly syndrome AR 9 17
GBA* Gaucher disease AR 84 488
GBE1 Glycogen storage disease AR 36 70
GFPT1 Myasthenic syndrome, congenital AR 13 42
GLDN Lethal congenital contracture syndrome 11 AR 11 11
GLE1 Lethal congenital contracture syndrome, Arthrogryposis, lethal, with anterior horn cell disease AR 7 17
KAT6B Ohdo syndrome, SBBYS variant, Genitopatellar syndrome AD 47 73
KIAA1109 Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome AR 7 16
KLHL40 Nemaline myopathy AR 11 26
LGI4 Arthrogryposis multiplex congenita, neurogenic, with myelin defect AR 9 7
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type AD/AR 250 564
MPZ Neuropathy, Roussy-Levy syndrome, Dejerine-Sottas disease, Charcot-Marie-Tooth disease AD 108 241
MTM1 Myopathy, centronuclear XL 158 301
MUSK Myasthenic syndrome, congenital, Fetal akinesia deformation sequence AR 17 22
MYBPC1 Arthrogryposis, Lethal congenital contractural syndrome AD/AR 7 7
MYH2 Proximal myopathy and ophthalmoplegia AD/AR 24 24
MYH3 Arthrogryposis AD/AR 21 45
MYH8 Carney complex variant, Arthrogryposis, distal, type 7, Trismus-pseudocamptodactyly syndrome AD 1 2
NALCN Neuroaxonal neurodegeneration, infantile, with facial dysmophism, Congenital contractures of the limbs and face, hypotonia, and developmental delay AD/AR 47 50
NEB#* Nemaline myopathy AR 305 309
PIEZO2* Marden-Walker syndrome, Distal arthrogryposis AD/AR 30 28
PLOD2 Bruck syndrome, Osteogenesis imperfecta type 3 AR 8 23
PMM2 Congenital disorder of glycosylation AR 76 128
PPP3CA Epilepitic encephalopathy AD 8 11
RAPSN Myasthenic syndrome, congenital AR 26 58
RARS2 Pontocerebellar hypoplasia AR 23 37
RIPK4 Popliteal pterygium syndrome, lethal type, Bartsocas-Papas syndrome AR 4 15
SCO2 Leigh syndrome, Hypertrophic cardiomyopathy (HCM), Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, Myopia AR 42 37
SELENON# Muscular dystrophy, rigid spine, Myopathy, congenital, with fiber- disproportion AR 38 63
SMN1#* Spinal muscular atrophy AR 29 111
SMN2#* Spinal muscular atrophy AD 1 9
TGFB3 Loeys-Dietz syndrome (Reinhoff syndrome), Arrhythmogenic right ventricular dysplasia AD 19 26
TK2# Mitochondrial DNA depletion syndrome AR 38 52
TNNI2 Arthrogryposis multiplex congenita AD 5 11
TNNT1 Nemaline myopathy AR 6 8
TNNT3 Arthyrgryposis, distal, type 2B AD 3 4
TPM2 CAP myopathy, Nemaline myopathy, Arthrogryposis, distal AD 18 38
TPM3* CAP myopathy, Nemaline myopathy, Myopathy, congenital, with fiber- disproportion AD/AR 21 27
TRPV4 Metatropic dysplasia, Spondyloepiphyseal dysplasia Maroteaux type, Parastremmatic dwarfism, Hereditary motor and sensory neuropathy, Spondylometaphyseal dysplasia Kozlowski type, Spinal muscular atrophy, Charcot-Marie-Tooth disease, Brachyolmia (autosomal dominant type), Familial Digital arthropathy with brachydactyly AD 61 78
TSEN2# Pontocerebellar hypoplasia AR 8 5
TSEN54 Pontocerebellar hypoplasia AR 23 21
UBA1 Spinal muscular atrophy, infantile XL 3 5
VIPAS39 Arthrogryposis, renal dysfunction, and cholestasis 2 AR 8 13
VPS33B Arthrogryposis - renal dysfunction - cholestasis AR 17 58
VRK1 Pontocerebellar hypoplasia AR 9 9
ZBTB42 Lethal congenital contracture syndrome AR 2 1
ZC4H2 Wieacker-Wolff syndrome XL 20 16
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Arthrogryposes Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
CHRNE Chr17:4804936 c.501-16G>A NM_000080.3
CHRNE Chr17:4806452 c.-94G>A NM_000080.3
CHRNE Chr17:4806453 c.-95G>A NM_000080.3
CHRNE Chr17:4806454 c.-96C>T NM_000080.3 rs748144899
COL6A2 Chr21:47538492 c.1117-35_1118dupAAAAGACGTGAGGCTGATTCTGCAAACCCTTCCAGGG NM_001849.3
COL6A2 Chr21:47541407 c.1459-63G>A NM_001849.3
ERCC5 Chr13:103514354 c.881-26T>G NM_000123.3
ERCC6 Chr10:50681659 c.2599-26A>G NM_000124.3 rs4253196
EXOSC3 Chr9:37782146 c.475-12A>G NM_016042.3 rs370087266
FBN2 Chr5:127670560 c.3974-24A>C NM_001999.3
FBN2 Chr5:127670562 c.3974-26T>G NM_001999.3
FBN2 Chr5:127671284 c.3725-15A>G NM_001999.3
FKTN Chr9:108368857 c.648-1243G>T NM_006731.2
GBA Chr1:155205646 c.1225-14_1225-11delTGTCinsAGT NM_000157.3
GBA Chr1:155208109 c.589-12C>G NM_000157.3
GBA Chr1:155211053 c.-150A>G NM_000157.3 rs1232943445
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
MTM1 ChrX:149767035 c.137-19_137-16delACTT NM_000252.2
MTM1 ChrX:149767045 c.137-11T>A NM_000252.2
MTM1 ChrX:149783032 c.232-26_232-23delGACT NM_000252.2
MTM1 ChrX:149808833 c.529-909A>G NM_000252.2
MTM1 ChrX:149818176 c.868-13T>A NM_000252.2
NEB Chr2:152355017 c.24220-151C>A NM_001271208.1
PMM2 Chr16:8891573 NM_000303.2
PMM2 Chr16:8898599 c.179-25A>G NM_000303.2 rs760689221
PMM2 Chr16:8926102 c.640-15479C>T NM_000303.2 rs1258107584
PMM2 Chr16:8941558 c.640-23A>G NM_000303.2
RAPSN Chr11:47469717 c.193-15C>A NM_005055.4
RAPSN Chr11:47470715 c.-199C>G NM_005055.4
RAPSN Chr11:47470726 c.-210A>G NM_005055.4 rs786200905
RARS2 Chr6:88244587 c.613-3927C>T NM_020320.3
SELENON Chr1:26143316 c.*1107T>C NM_020451.2
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
VPS33B Chr15:91550814 c.499-11G>A NM_018668.3

Test Strengths

All exons of the *GBA* gene have segmentally duplicated pseudogenes that reduce sensitivity of NGS diagnostics in general. However, Blueprint Genetics custom assay has good coverage (>20x) with high mapping rates (mapping quality >40) for 100.0% of the target regions in *GBA* gene. Our validation showed high mean coverage of 184X for the *GBA* gene. Thus, our NGS Panel is not expected to have major limitations in detecting variants in *GBA* gene although clinical validation has not been performed at large scale for Gaucher disease.

Deletion / duplication analysis (either in isolation or as part of Plus analysis including sequencing) testing can detect the copy number of *SMN1* exon 7, which is commonly used as a marker for copy number of the *SMN1* gene. In individuals identified to have homozygous *SMN1* deletions, we include reporting of *SMN2* copy number.

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: SELENON NM_020451.3:3, TK2 NM_001271934.2:3, TSEN2 NM_001321278.2:12. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases, and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis includes a combination of both sequence variants (single nucleotide variants (SNV’s) and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter paper cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.